


Molecular weight
46.45 kDa
Protein length
Gene length
pyrimidine biosynthesis

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0044 (Galperin et al., 2021)

This gene is a member of the following regulons

1,621,374 → 1,622,660
Visit Visit
The protein
Catalyzed reaction/ biological activity
[metabolite|(S)-dihydroorotate] + H2O --> H+ + [metabolite|N-carbamoyl-L-aspartate] (according to UniProt)
Protein family
[wiki|Metallo-dependent hydrolases superfamily] (according to UniProt)
[PDB|3GRI] (from ''Staphylococcus aureus subsp. aureus mw2'', 60% identity, 72% similarity)
Paralogous protein(s)
Expression and Regulation
induced in the absence of uridine nucleotides ([protein|search|PyrR]) [Pubmed|8206849]
regulatory mechanism
[protein|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]: termination, via [wiki|RNA switch], in [regulon|protein:6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1709162], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2024-06-18 17:36:24





Biological materials
BKE15500 (Δ[gene|CA16FD3507DCCADB1E01DF25B42C3405C9205B05|pyrC]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATTTTCGTTTAGTATCCAGC,  downstream forward: _UP4_TATGAAGAGGGGAGACTTGT
BKK15500 (Δ[gene|CA16FD3507DCCADB1E01DF25B42C3405C9205B05|pyrC]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATTTTCGTTTAGTATCCAGC,  downstream forward: _UP4_TATGAAGAGGGGAGACTTGT


Page visits: 2391

Time of last update: 2024-06-21 01:56:01

Author of last update: Jstuelk