anti-[wiki|sigma factor] to [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF], protein serine kinase, phosphorylates [protein|3936E91C062074BFE4284B54A8CC33F35F94F5EE|spoIIAA]

Molecular weight
16.21 kDa
Protein length
Gene length
control of [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF] activity; phosphorylation and inactivation of [protein|3936E91C062074BFE4284B54A8CC33F35F94F5EE|spoIIAA]
anti-[wiki|sigma factor], protein serine kinase

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2172 (Galperin et al., 2021)

This gene is a member of the following regulons

2,444,208 → 2,444,648
Phenotypes of a mutant
the mutant tends to acquire suppressor mutations that result in improved growth and colony morphology [Pubmed|28189581]
Visit Sartorius.com Visit Sartorius.com
The protein
Catalyzed reaction/ biological activity
phosphorylation of [protein|3936E91C062074BFE4284B54A8CC33F35F94F5EE|spoIIAA]
negative regulator (by binding) of [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]
ATP + L-seryl-[protein] --> ADP + H+ + O-phospho-L-seryl-[protein] (according to UniProt)
ATP + L-threonyl-[protein] --> ADP + H+ + O-phospho-L-threonyl-[protein] (according to UniProt)
Protein family
anti-sigma-factor family (with [protein|5AF5F199C5D92E13DE1C56E28948A557E3954CBF|rsbW], according to UniProt)
[PDB|1L0O] (complex with [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF], Geobacillus stearothermophilus) [pubmed|11955433]
[PDB|1TIL] (complex with [protein|3936E91C062074BFE4284B54A8CC33F35F94F5EE|spoIIAA], Geobacillus stearothermophilus) [pubmed|15236958]
Expression and Regulation
''[wiki|spoIIAA]'': expressed early during sporulation
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, [PubMed|1556084,15687200], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
[protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]: sigma factor, in [regulon|protein:DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH regulon]
Open in new tab


2024-07-03 09:04:04





''[wiki|spoIIAA]'': expressed early during sporulation
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|15699190], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab


2024-07-04 03:41:30





Biological materials
BKE23460 (Δ[gene|C8B867758330355F44C63CC284DC7AA3061FB9F1|spoIIAB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE23460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAACTCAAGGTGCATTTCAT,  downstream forward: _UP4_CTTTGTAATTAAGGAGATTT
BKK23460 (Δ[gene|C8B867758330355F44C63CC284DC7AA3061FB9F1|spoIIAB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK23460 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AAACTCAAGGTGCATTTCAT,  downstream forward: _UP4_CTTTGTAATTAAGGAGATTT
[wiki|Charles Moran], Emory University, NC, USA [http://www.microbiology.emory.edu/moran_c.html homepage]
Original Publications


Page visits: 4192

Time of last update: 2024-07-15 22:19:46

Author of last update: Jstuelk