

1,2,-dihydroxy-3-keto-5-methylthiopentene dioxygenase

Molecular weight
20.68 kDa
Protein length
Gene length
methionine salvage
1,2,-dihydroxy-3-keto-5-methylthiopentene dioxygenase
mtnD, ykrZ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1791 (Galperin et al., 2021)

This gene is a member of the following regulons

1,429,584 1,430,120
Visit Visit
The protein
Catalyzed reaction/ biological activity
1,2-dihydroxy-5-(methylsulfanyl)pent-1-en-3-one + O2 --> 3-(methylsulfanyl)propanoate + CO + formate + 2 H+ (according to UniProt)
1,2-dihydroxy-5-(methylsulfanyl)pent-1-en-3-one + O2 --> 4-methylsulfanyl-2-oxobutanoate + formate + 2 H+ (according to UniProt)
Protein family
acireductone dioxygenase (ARD) family (single member, according to UniProt)
[PDB|4QGL] (from B. anthracis, 71% identity)
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
induced by methionine starvation ([wiki|S-box]) [Pubmed|10094622]
regulatory mechanism
S-box: RNA switch, , the [wiki|S-box] [wiki|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|other_regulator:S-box|S-box]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12022921], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2024-06-20 06:43:32





Biological materials
MGNA-A786 (ykrZ::erm), available at the [ NBRP B. subtilis, Japan]
BKE13620 ([gene|C7D9E701B2CA2C9E85D69CAD6E0A45BE590BAED9|mtnD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCAATTCCTCCTTTTA, downstream forward: _UP4_TAAGCGTGAGATAGCCCCGT
BKK13620 ([gene|C7D9E701B2CA2C9E85D69CAD6E0A45BE590BAED9|mtnD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCAATTCCTCCTTTTA, downstream forward: _UP4_TAAGCGTGAGATAGCCCCGT


Page visits: 4848

Time of last update: 2024-06-21 19:26:09

Author of last update: Melvin.boenninger