desK

desK
168

two-component sensor kinase, regulation of cold shock expression of [gene|644C0C354B72FC07222EE45F4D2E0E57434B5EB5|des]

locus
BSU_19190
Molecular weight
42.51 kDa
pI
9.43
Protein length
Gene length
function
regulation of cold shock expression of [gene|644C0C354B72FC07222EE45F4D2E0E57434B5EB5|des]
product
two-component sensor kinase
essential
no
synonyms
desK, yocF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4585 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,090,574 → 2,091,686
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
autophosphorylation, phosphorylation of [protein|F08BE4ACC0ECE1416B012CA72B027423D4D9B00A|desR]
ATP + [protein|C5F9A1970393625B01C05C72C9A240C8EE8789D3|desK] L-histidine --> ADP + [protein|C5F9A1970393625B01C05C72C9A240C8EE8789D3|desK]-N-phospho-L-histidine (according to UniProt)
[wiki|Domains]
5 transmembrane helices
cytoplasmatic C-terminal trail
[wiki|Histidine kinase domain] (aa 186-369) (according to UniProt)
[wiki|Cofactors]
Mg2+ [pubmed|36693130]
Structure
[PDB|3EHF] [Pubmed|19805278]
[PDB|5IUJ]([protein|C5F9A1970393625B01C05C72C9A240C8EE8789D3|desK]-[protein|F08BE4ACC0ECE1416B012CA72B027423D4D9B00A|desR] complex in the phosphotransfer state with low Mg2+ [20 mM]) [Pubmed|27938660]
[PDB|5IUK]([protein|C5F9A1970393625B01C05C72C9A240C8EE8789D3|desK]-[protein|F08BE4ACC0ECE1416B012CA72B027423D4D9B00A|desR] complex in the phosphotransfer state with high Mg2+ [150 mM] and BeF3) [Pubmed|27938660]
[PDB|5IUM](phosphorylated wild type [protein|C5F9A1970393625B01C05C72C9A240C8EE8789D3|desK]C) [Pubmed|27938660]
[PDB|5IUN]([protein|C5F9A1970393625B01C05C72C9A240C8EE8789D3|desK]-[protein|F08BE4ACC0ECE1416B012CA72B027423D4D9B00A|desR] complex in the phosphatase state) [Pubmed|27938660]
[AF|O34757]
Modification
autophosphorylation on a His residue
Effectors of protein activity
unsaturated fatty acids are negative effectors of the system
acidic pH results in protonation of glutamate residues and breaking of intramolecular salt bridges, this results in helix destabilization, [protein|F08BE4ACC0ECE1416B012CA72B027423D4D9B00A|desR] will not be activated [pubmed|32823946]
Paralogous protein(s)
[protein|91110611D775A1746766D43BDF50F2F6D345B625|yvfT]
[wiki|Localization]
membrane (transmembrane segments)
Additional information
[protein|C5F9A1970393625B01C05C72C9A240C8EE8789D3|desK] has the ability to sense changes in membrane fluidity [Pubmed|17087771]
Expression and Regulation
Operons
genes
[gene|C5F9A1970393625B01C05C72C9A240C8EE8789D3|desK]-[gene|F08BE4ACC0ECE1416B012CA72B027423D4D9B00A|desR]
description
[Pubmed|11285232]
regulation
induced by cold shock (12-fold) [Pubmed|12399512]
Open in new tab

[gene|C5F9A1970393625B01C05C72C9A240C8EE8789D3|desK]→[gene|F08BE4ACC0ECE1416B012CA72B027423D4D9B00A|desR]

2024-06-19 02:17:02

ghost

73

25b9128a8b7f56b50905080b061f40a8b0014210

F2EF1E99AB7B6CD97A042B3BC67273F913364739

Biological materials
Mutant
MGNA-A327 (yocF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/327 NBRP B. subtilis, Japan]
BKE19190 (Δ[gene|C5F9A1970393625B01C05C72C9A240C8EE8789D3|desK]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE19190 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATCTTACCTCATTTTC,  downstream forward: _UP4_AAATAAACATAAAGGATGGC
BKK19190 (Δ[gene|C5F9A1970393625B01C05C72C9A240C8EE8789D3|desK]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK19190 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATCTTACCTCATTTTC,  downstream forward: _UP4_AAATAAACATAAAGGATGGC
labs
[wiki|Diego de Mendoza], Universidad Nacional de Rosario, Argentine [http://www.ibr.gov.ar/eng/investigacion/demendoza.htm homepage]
References
Reviews
20117042,17087771,24819366
Original Publications
10094672,14734164,12399512,20507988,19233289,11285232,19805278,15090506,12207704,20705470,23356219,24574048,24522108,25406381,26172072,27528507,27938660,28475313,29269314,30431418,31772055,32823946,34201916,36693130,38717171

C5F9A1970393625B01C05C72C9A240C8EE8789D3

Page visits: 1864

Time of last update: 2024-06-20 06:12:44

Author of last update: Jstuelk