refZ

refZ
168

regulator of [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|ftsZ] ([wiki|TetR family]), facilitates switch from medial to polar [protein|search|FtsZ ]ring placement during sporulation

locus
BSU_29630
Molecular weight
24.24 kDa
pI
6.71
Protein length
Gene length
function
relocalization of the [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|ftsZ] ring, placement of the sporulation septum
product
regulator of [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|ftsZ]
essential
no
synonyms
refZ, yttP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1309 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,032,417 → 3,033,040
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
facilitates switch from medial to polar [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|ftsZ] ring placement during [wiki|sporulation] [Pubmed|22730127]
binds to specific DNA motifs (RBMs) that localize near the poles at the time of septation [pubmed|31160399]
facilitates the timely assembly of polar Z-rings and partially defines the region of chromosome initially captured in the forespore [pubmed|31160399]
a [gene|C5F67C3ACB06A5029B4AE69A065BC55622372404|refZ] [gene|559DEDC9887B811EF80994526256ADC48BA51CE3|noc] double mutant is defective in cell division and exhibits reduced sporulation [pubmed|35506695]
Protein family
[wiki|TetR family]
[wiki|Domains]
TetR-like DNA-binding helix-turn-helix domain at the N-terminus [Pubmed|22730127]
[wiki|HTH tetR-type domain] (aa 3-63) (according to UniProt)
Structure
[PDB|6MJ1]
[AF|O34970]
[wiki|Localization]
polar foci [Pubmed|22730127]
at the side of asymmetric septum formation at the mother cell side of the septum (depends on [protein|7C8DFE00A2B2B30CC8BEB35055D92CC2E4128F3A|spoIIE]) [pubmed|38705388]
Expression and Regulation
Operons
genes
[gene|C5F67C3ACB06A5029B4AE69A065BC55622372404|refZ]
description
[Pubmed|22383849]
regulation
expressed under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|14762014]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|12850135], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: activation, [Pubmed|14651647], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP]: activation, [Pubmed|14762014], in [regulon|protein:638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|phoP regulon]
Open in new tab

[gene|C5F67C3ACB06A5029B4AE69A065BC55622372404|refZ]

2024-06-17 18:08:53

ghost

77

fcf30a6ba4d335bf69b7a9553cc290e64f49a9f0

9CF59A71B0ED31690A3D816F1393AB51D42205D9

Biological materials
Mutant
MGNA-A426 (yttP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/426 NBRP B. subtilis, Japan]
BKE29630 (Δ[gene|C5F67C3ACB06A5029B4AE69A065BC55622372404|refZ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE29630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACGGCTCACTCCTTCCT,  downstream forward: _UP4_AACTAGCACCGTTCCAAAAA
BKK29630 (Δ[gene|C5F67C3ACB06A5029B4AE69A065BC55622372404|refZ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK29630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACGGCTCACTCCTTCCT,  downstream forward: _UP4_AACTAGCACCGTTCCAAAAA
References
Reviews
24006471
Original Publications
14651647,14762014,12850135,22730127,22383849,26360512,30092000,31160399,35506695,38705388

C5F67C3ACB06A5029B4AE69A065BC55622372404

Page visits: 3286

Time of last update: 2024-06-20 18:15:05

Author of last update: Jstuelk