mstX

mstX
168

membrane-integrating protein for membrane protein expression, MISTIC

locus
BSU_31321
Molecular weight
13.00 kDa
pI
4
Protein length
Gene length
function
unknown
product
MISTIC
essential
no
synonyms
mstX

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,218,525 → 3,218,857
Phenotypes of a mutant
reduced [wiki|biofilm formation] (can be suppressed by inactivation of ''[gene|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]'') [Pubmed|23737939]
overexpression result in increased [wiki|biofilm formation] even in a domesticated strain background [Pubmed|23737939]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Structure
[PDB|1YGM] [Pubmed|15731457]
[AF|Q5BU39]
[wiki|Localization]
integral membrane protein that folds autonomously into the membrane, bypassing the cellular translocon machinery [Pubmed|15731457]
Expression and Regulation
Operons
genes
[gene|C5C72925567927CC177CCAC5369F80D57B9FAB5F|mstX]-[gene|752860E73AD1A72D6598F995B80F5B21A77A5CBD|yugO]
description
[Pubmed|23737939]
regulation
repressed by [protein|search|SinR] [Pubmed|23737939]
regulatory mechanism
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, [Pubmed|23737939], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
additional information
potassium exporter activity of YugO is activated by glutamate limitation via the C-terminal domain [Pubmed|26503040]
Open in new tab

[gene|C5C72925567927CC177CCAC5369F80D57B9FAB5F|mstX]→[gene|752860E73AD1A72D6598F995B80F5B21A77A5CBD|yugO]

2024-07-07 05:20:17

ghost

90

85f2f42956c5da924414be7f576e297b57104a91

B36C37BD378E93291602921CA84AE3502A5DD7AC

Biological materials
Mutant
BKE31321 (Δ[gene|C5C72925567927CC177CCAC5369F80D57B9FAB5F|mstX]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE31321 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATAAAACCGGATTTCTC,  downstream forward: _UP4_GTATCTGAAGAAGGAGAAAA
BKK31321 (Δ[gene|C5C72925567927CC177CCAC5369F80D57B9FAB5F|mstX]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK31321 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATAAAACCGGATTTCTC,  downstream forward: _UP4_GTATCTGAAGAAGGAGAAAA
Reviews
35195292
Original Publications
16704729,19475664,21097953,15731457,23737939,25177765,31459283

C5C72925567927CC177CCAC5369F80D57B9FAB5F

Page visits: 3267

Time of last update: 2024-07-16 03:02:09

Author of last update: Jstuelk