acoC

acoC
168

acetoin dehydrogenase E2 component (dihydrolipoamide acetyltransferase)

locus
BSU_08080
Molecular weight
42.73 kDa
pI
6.52
Protein length
Gene length
function
acetoin utilization
product
acetoin dehydrogenase E2 component (dihydrolipoamide acetyltransferase)
essential
no
ec
2.3.1.12
synonyms
acoC, yfjI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0508 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
881,049 → 882,245
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
(R)-N6-dihydrolipoyl-L-lysyl-[protein] + acetyl-CoA --> (R)-N6-(S8-acetyldihydrolipoyl)-L-lysyl-[protein] + CoA (according to UniProt)
Protein family
[wiki|2-oxoacid dehydrogenase family] (according to UniProt)
[wiki|Domains]
[wiki|Lipoyl-binding domain] (aa 2-77) (according to UniProt)
[wiki|Peripheral subunit-binding domain] (PSBD) (aa 118-155) (according to UniProt)
[wiki|Cofactors]
lipoic acid
Structure
[PDB|3DUF] (PDH from Geobacillus stearothermophilus, 33% identity) [pubmed|19081062]
[AF|O31550]
Paralogous protein(s)
[protein|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB], [protein|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|bkdB], [protein|2F40086E35FA32136B9A89C530A86D714FE9460C|pdhC]
[wiki|Localization]
Membrane-proximal (Spotty) [Pubmed|16479537]
Expression and Regulation
Operons
genes
[gene|B0A333BDFAE816B48B856A1DD91B73C41584A8E4|acoA]-[gene|5F953C3C91EB65A031D04A1D91F1CF501F8EFD09|acoB]-[gene|C4B6C3EE560C8BD353FEABB1A607C89C20DC8D34|acoC]-[gene|2ECF05AEE1549861EB3AE62139F0E9DEE0B0F632|acoL]
description
[pubmed|11274109]
regulation
induced by acetoin ([protein|706864AAF36684AD5E46F30E9EB76315AB412700|acoR]) [http://www.ncbi.nlm.nih.gov/sites/entrez/11274109 PubMed]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|10666464], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|706864AAF36684AD5E46F30E9EB76315AB412700|acoR]: activation, (interaction with [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL]-containing [wiki|RNA polymerase]) [ PubMed|11274109], in [regulon|protein:706864AAF36684AD5E46F30E9EB76315AB412700|acoR regulon]
[protein|7165CC59CDAF64AAE2D591936860304A53BE5DF6|fnr]: indirect positive regulation, in [regulon|protein:7165CC59CDAF64AAE2D591936860304A53BE5DF6|fnr regulon]
sigma factors
[protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL]: sigma factor, [PubMed|11274109], in [regulon|protein:1118A21CC581B0470EC6E7C178F2523CDCA70F93|sigL regulon]
additional information
the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|21815947]
Open in new tab

[gene|B0A333BDFAE816B48B856A1DD91B73C41584A8E4|acoA]→[gene|2ECF05AEE1549861EB3AE62139F0E9DEE0B0F632|acoL]

2024-05-21 18:38:04

Bzhu

99

13d8d82e494fdc730b04ec27f52013adc2c6a3b0

0F3039221AB7F088A4D6093D7D4525D99014DE74

additional information
the mRNA is very stable (> 15 min) [pubmed|12884008]
Biological materials
Mutant
MGNA-C282 (acoC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2280 NBRP B. subtilis, Japan]
BKE08080 (Δ[gene|C4B6C3EE560C8BD353FEABB1A607C89C20DC8D34|acoC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE08080 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTTACCGCCATTTGTGTCC,  downstream forward: _UP4_TAGGAAAAGCAGGTGAAAAC
BKK08080 (Δ[gene|C4B6C3EE560C8BD353FEABB1A607C89C20DC8D34|acoC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK08080 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTTACCGCCATTTGTGTCC,  downstream forward: _UP4_TAGGAAAAGCAGGTGAAAAC
labs
[wiki|Michel Debarbouille], Pasteur Institute, Paris, France [http://www.pasteur.fr/ip/easysite/go/03b-00000m-0ob/recherche/departements-scientifiques/microbiologie/unites-et-groupes/unite-de-biologie-des-bacteries-pathogenes-a-gram-positif/les-membres-de-l-equipe Homepage]
References
Reviews
27074917,38624243
Original Publications
11274109,10368162,10666464,16479537,16428414,12884008,21815947,19081062,31066113

C4B6C3EE560C8BD353FEABB1A607C89C20DC8D34

Page visits: 3901

Time of last update: 2024-06-19 23:01:55

Author of last update: Jstuelk