

imidazole glycerol phosphate synthase (synthase subunit)

Molecular weight
27.14 kDa
Protein length
Gene length
biosynthesis of histidine
imidazole glycerol phosphate synthase (synthase subunit)

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0107 (Galperin et al., 2021)

This gene is a member of the following regulons

3,583,562 3,584,320
Visit Sartorius.com Visit Sartorius.com
The protein
Catalyzed reaction/ biological activity
5-[(5-phospho-1-deoxy-D-ribulos-1-ylimino)methylamino]-1-(5-phospho--D-ribosyl)imidazole-4-carboxamide + L-glutamine --> 5-amino-1-(5-phospho--D-ribosyl)imidazole-4-carboxamide + D-erythro-1-(imidazol-4-yl)glycerol 3-phosphate + H+ + L-glutamate (according to UniProt)
Protein family
HisA/HisF family (with [protein|148F0C7983250F50676D234DB713E532AA55DDBF|hisA], according to UniProt)
[PDB|1KA9] (the [protein|C22C15754859B2510E52622E6A5DFAF97A7AD4E5|hisF]-[protein|DEB3122A3EA36545759FAA6F86F71F971CA5F011|hisH] complex from ''Thermus thermophilus'', 59% identity) [Pubmed|12417026]
Paralogous protein(s)
cytoplasm (according to Swiss-Prot)
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
expression during spore [wiki|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
expression depends on functional [protein|F4097349A563503468A2A14F062AEAC532C7917A|rnpM] [pubmed|30355672]
regulatory mechanism
[protein|F4097349A563503468A2A14F062AEAC532C7917A|rnpM]: unknown, [pubmed|30355672], in [regulon|protein:F4097349A563503468A2A14F062AEAC532C7917A|rnpM regulon]
Open in new tab


2024-05-21 21:14:32





Biological materials
BKE34870 ([gene|C22C15754859B2510E52622E6A5DFAF97A7AD4E5|hisF]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE34870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCATGGGATAATCCGTTTTG, downstream forward: _UP4_AAAGAGTACGGGGTGAATGT
BKK34870 ([gene|C22C15754859B2510E52622E6A5DFAF97A7AD4E5|hisF]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK34870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCATGGGATAATCCGTTTTG, downstream forward: _UP4_AAAGAGTACGGGGTGAATGT
Original Publications


Page visits: 3039

Time of last update: 2024-05-22 22:53:01

Author of last update: Melvin.boenninger