pyrK

pyrK
168

dihydroorotic acid dehydrogenase (electron transfer subunit)

locus
BSU_15530
Molecular weight
27.95 kDa
pI
5.58
Protein length
Gene length
function
pyrimidine biosynthesis
product
dihydroorotic acid dehydrogenase (electron transfer subunit)
essential
no
synonyms
pyrK, pyrDII, ylxD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0543 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,626,948 1,627,718
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Protein family
PyrK family (single member, according to UniProt)
[wiki|Domains]
[wiki|FAD-binding FR-type domain] (aa 1-101) (according to UniProt)
[wiki|Cofactors]
[2Fe-2S] cluster [pubmed|29292548,11188687]
FAD [pubmed|11188687]
Structure
[PDB|1EP1] (from Lactococcus lactis, 46% identity) [pubmed|11188687]
[AF|P25983]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]-[gene|A5C26E10085868A0A193C450DF58D54C636B7C2D|pyrP]-[gene|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB]-[gene|CA16FD3507DCCADB1E01DF25B42C3405C9205B05|pyrC]-[gene|E7741ED6F15044900BDC5F0584246469D2D4D586|pyrAA]-[gene|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB]-[gene|C20A05AE4CE8AEE0DA767334935CC64106A7FCCB|pyrK]-[gene|E533BEF28579CD04B24E2C728737269E35224450|pyrD]-[gene|5D0D0D2413377FCA92440334E92B5A27A5963D9E|pyrF]-[gene|0197A037D2AF049B295E1DA60187D4614B2BAC51|pyrE]
description
[Pubmed|8206849]
regulation
induced in the absence of uridine nucleotides ([protein|search|PyrR]) [Pubmed|8206849]
regulatory mechanism
[protein|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]: termination, via [wiki|RNA switch], in [regulon|protein:6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1709162], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]→[gene|0197A037D2AF049B295E1DA60187D4614B2BAC51|pyrE]

2024-05-16 00:12:45

ghost

83

3b978222b0b6a5230a2e7701ac35d1e35cc85307

0A8FD5CB6489EDD8CB2074130B763DCAC1F24654

Biological materials
Mutant
BKE15530 ([gene|C20A05AE4CE8AEE0DA767334935CC64106A7FCCB|pyrK]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE15530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACATACTGTCAAATACGCTT, downstream forward: _UP4_AAAGCTCAGGAGGTGGCGCT
BKK15530 ([gene|C20A05AE4CE8AEE0DA767334935CC64106A7FCCB|pyrK]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK15530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACATACTGTCAAATACGCTT, downstream forward: _UP4_AAAGCTCAGGAGGTGGCGCT
References
8206849,8759868,1709162,10545205,15378759,11188687

C20A05AE4CE8AEE0DA767334935CC64106A7FCCB

Page visits: 3842

Time of last update: 2024-05-23 07:30:16

Author of last update: Melvin.boenninger