

dihydroorotic acid dehydrogenase (electron transfer subunit)

Molecular weight
27.95 kDa
Protein length
Gene length
pyrimidine biosynthesis
dihydroorotic acid dehydrogenase (electron transfer subunit)
pyrK, pyrDII, ylxD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0543 (Galperin et al., 2021)

This gene is a member of the following regulons

1,626,948 1,627,718
Visit Visit
The protein
Protein family
PyrK family (single member, according to UniProt)
[wiki|FAD-binding FR-type domain] (aa 1-101) (according to UniProt)
[2Fe-2S] cluster [pubmed|29292548,11188687]
FAD [pubmed|11188687]
[PDB|1EP1] (from Lactococcus lactis, 46% identity) [pubmed|11188687]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
induced in the absence of uridine nucleotides ([protein|search|PyrR]) [Pubmed|8206849]
regulatory mechanism
[protein|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]: termination, via [wiki|RNA switch], in [regulon|protein:6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1709162], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2024-06-18 17:36:24





Biological materials
BKE15530 ([gene|C20A05AE4CE8AEE0DA767334935CC64106A7FCCB|pyrK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACATACTGTCAAATACGCTT, downstream forward: _UP4_AAAGCTCAGGAGGTGGCGCT
BKK15530 ([gene|C20A05AE4CE8AEE0DA767334935CC64106A7FCCB|pyrK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACATACTGTCAAATACGCTT, downstream forward: _UP4_AAAGCTCAGGAGGTGGCGCT


Page visits: 3927

Time of last update: 2024-07-14 19:02:28

Author of last update: Melvin.boenninger