yybP

yybP
168

membrane protein, may be involved in manganese detoxification

locus
BSU_40560
Molecular weight
15.83 kDa
pI
4.24
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yybP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
4,169,166 → 4,169,612
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Structure
[PDB|3LLL] (from the mouse, 28% identity) [pubmed|20471395]
[AF|P37488]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|BD3A3D84AD3A21B634B8EBAF684B690FE02BD857|yybP]
description
[Pubmed|25794618]
regulation
induced in the presence of Mn2+ ([wiki|yybP-ykoY motif]) [Pubmed|25794618]
the [wiki|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
yybP-ykoY motif: RNA switch, in the presence of the ligand Mn2+ [Pubmed|25794618], in [regulon|other_regulator:yybP-ykoY motif|yybP-ykoY motif]
Open in new tab

[gene|BD3A3D84AD3A21B634B8EBAF684B690FE02BD857|yybP]

2024-07-10 02:44:18

Jstuelk

47

d54611f836c7261d0257457f4faa9594ab394bc4

71DA6C6DC5ECBA1FD7A1336DA7B871ACD3BC072F

Biological materials
Mutant
MGNA-B838 (yybP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1837 NBRP B. subtilis, Japan]
BKE40560 (Δ[gene|BD3A3D84AD3A21B634B8EBAF684B690FE02BD857|yybP]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE40560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTCAGCCCCCTCATCG,  downstream forward: _UP4_TAAGAAAAAGCATCCCGACG
BKK40560 (Δ[gene|BD3A3D84AD3A21B634B8EBAF684B690FE02BD857|yybP]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK40560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTCAGCCCCCTCATCG,  downstream forward: _UP4_TAAGAAAAAGCATCCCGACG
References
15096624,25794618,25794619,20471395,29794222

BD3A3D84AD3A21B634B8EBAF684B690FE02BD857

Page visits: 3321

Time of last update: 2024-07-15 08:13:20

Author of last update: Melvin.boenninger