

transcriptional antiterminator of the [gene|search|hut ]operon

Molecular weight
16.43 kDa
Protein length
Gene length
regulation of histidine utilization
transcriptional antiterminator
hutP, hutP1

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

4,041,483 → 4,041,938
Visit Visit
The protein
Protein family
hutP family (single member, according to UniProt)
Mg2+ [pubmed|29035529]
L-His [pubmed|23748184]
[PDB|3BOY] (complex bound  to the [gene|search|hut] mRNA),  [PDB|1WPT]
Effectors of protein activity
HutP binds its RNA target to cause antitermination in the presence of histidine [Pubmed|23748184]
Expression and Regulation
induced by histidine ([protein|search|HutP]) [Pubmed|8071225]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|8071225], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|8682780], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP]: antitermination, at a protein-dependent [wiki|RNA switch] located between [gene|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP] and [gene|DB0FDF43A6829692D3E6B9CDE9D0F4AA1E3EB888|hutH] [Pubmed|8071225], in [regulon|protein:BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8071225], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2024-07-09 18:58:13





Biological materials
BKE39340 (Δ[gene|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGAATCACTCAATTCC,  downstream forward: _UP4_TGAAACAGCCCATAGATCTT
BKK39340 (Δ[gene|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATGAATCACTCAATTCC,  downstream forward: _UP4_TGAAACAGCCCATAGATCTT
Research papers


Page visits: 3340

Time of last update: 2024-07-15 00:22:38

Author of last update: Jstuelk