nox

nox
168

NADH oxidase

locus
BSU_19550
Molecular weight
22.19 kDa
pI
5.27
Protein length
Gene length
function
regeneration of NAD from NADH
product
NADH oxidase
essential
no
synonyms
yodC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0778 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,127,813 → 2,128,421
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
NADH + H+ + O2 --> NAD+ + H2O [Pubmed|37106723,26312069]
Protein family
[wiki|nitroreductase family] (according to UniProt)
[wiki|Cofactors]
FAD [Pubmed|37106723]
Structure
[PDB|3GE6] (from '' Exiguobacterium sibiricum'', 42% identity)
[AF|P81102]
Expression and Regulation
Operons
genes
[gene|BC434FE0E92376A618ED34ACBB07B8A2E7F31DE6|nox]
description
[pubmed|22383849]
regulatory mechanism
[protein|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|yodB]: repression, [Pubmed|18208493], in [regulon|protein:73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|yodB regulon]
Open in new tab

[gene|BC434FE0E92376A618ED34ACBB07B8A2E7F31DE6|nox]

2024-07-04 02:43:57

Bzhu

48

6835af8714fe24eee6cdc4e7445502f63396506b

FC7E992FE26E5E30AAED8920F8861D7BDB01BCE0

Biological materials
Mutant
MGNA-B434 (yodC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1433 NBRP B. subtilis, Japan]
BKE19550 (Δ[gene|BC434FE0E92376A618ED34ACBB07B8A2E7F31DE6|nox]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE19550 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGTGTTTCCTCCTTCGG,  downstream forward: _UP4_TAAGGATATGAAAAACCTTA
BKK19550 (Δ[gene|BC434FE0E92376A618ED34ACBB07B8A2E7F31DE6|nox]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK19550 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGTGTTTCCTCCTTCGG,  downstream forward: _UP4_TAAGGATATGAAAAACCTTA
References
17407181,18208493,26312069,37106723,24525333

BC434FE0E92376A618ED34ACBB07B8A2E7F31DE6

Page visits: 2741

Time of last update: 2024-07-12 22:00:34

Author of last update: Jstuelk