glpD

glpD
168

glycerol-3-phosphate dehydrogenase (menaquinone 7)

locus
BSU_09300
Molecular weight
62.36 kDa
pI
8
Protein length
Gene length
function
glycerol utilization
product
glycerol-3-phosphate dehydrogenase (menaquinone 7)
essential
no
ec
1.1.5.3
synonyms
glpD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0578 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,004,975 → 1,006,642
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
quinone + sn-glycerol 3-phosphate --> quinol + dihydroxyacetone phosphate (according to UniProt)
Protein family
FAD-dependent glycerol-3-phosphate dehydrogenase family (single member, according to UniProt)
[wiki|Cofactors]
FAD (according to UniProt)
Structure
[PDB|3DA1] (from ''Bacillus halodurans'', 57% identity, 72% similarity)
[AF|P18158]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|BB42AE1AAFA3229649A8E210C1F6D7B61AF38BA1|glpD]
description
[Pubmed|2127799]
regulation
induced by glycerol ([protein|search|GlpP]) [Pubmed|1809833]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: activation, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|38767691AE7E09F46B9E97A60BF5358C1876EDF8|glpP]: antitermination, at a [wiki|RNA switch] [Pubmed|1809833], in [regulon|protein:38767691AE7E09F46B9E97A60BF5358C1876EDF8|glpP regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1809833], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|BB42AE1AAFA3229649A8E210C1F6D7B61AF38BA1|glpD]

2024-07-10 16:56:50

ghost

56

0de22157bc68a9b7b0579b06ff64224619cd7d50

442B20CD12F388D4E6BC03E9B61A5A1D90D3B2E2

Biological materials
Mutant
QB5347 (cat), available in the [wiki|Stülke] lab
BKE09300 (Δ[gene|BB42AE1AAFA3229649A8E210C1F6D7B61AF38BA1|glpD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE09300 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTACGTTTCCTCCTTGTT,  downstream forward: _UP4_TAAATCATAACGGGCTGTCT
BKK09300 (Δ[gene|BB42AE1AAFA3229649A8E210C1F6D7B61AF38BA1|glpD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK09300 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTACGTTTCCTCCTTGTT,  downstream forward: _UP4_TAAATCATAACGGGCTGTCT
References
36815589,8825777,1479885,9595668,9493382,20817675

BB42AE1AAFA3229649A8E210C1F6D7B61AF38BA1

Page visits: 5006

Time of last update: 2024-07-15 07:57:35

Author of last update: Jstuelk