pyrB

pyrB
168

[metabolite|aspartate] carbamoyltransferase

locus
BSU_15490
Molecular weight
34.02 kDa
pI
5.34
Protein length
Gene length
function
pyrimidine biosynthesis
product
[metabolite|aspartate] carbamoyltransferase
essential
no
ec
2.1.3.2
synonyms
pyrB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0540 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,620,476 → 1,621,390
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
[metabolite|carbamoyl-P] + L-[metabolite|aspartate] --> H+ + [metabolite|N-carbamoyl-L-aspartate] + [metabolite|phosphate] (according to UniProt)
Protein family
ATCase/OTCase family (with [protein|11E7D77EF9439F817C10BF5D9671C5AE66AF06DC|argF], according to UniProt)
Structure
[PDB|3R7D] [Pubmed|21663747]
[AF|P05654]
Modification
phosphorylation on Ser-303 [Pubmed|17218307]
Additional information
subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
Expression and Regulation
Operons
genes
[gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]-[gene|A5C26E10085868A0A193C450DF58D54C636B7C2D|pyrP]-[gene|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB]-[gene|CA16FD3507DCCADB1E01DF25B42C3405C9205B05|pyrC]-[gene|E7741ED6F15044900BDC5F0584246469D2D4D586|pyrAA]-[gene|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB]-[gene|C20A05AE4CE8AEE0DA767334935CC64106A7FCCB|pyrK]-[gene|E533BEF28579CD04B24E2C728737269E35224450|pyrD]-[gene|5D0D0D2413377FCA92440334E92B5A27A5963D9E|pyrF]-[gene|0197A037D2AF049B295E1DA60187D4614B2BAC51|pyrE]
description
[Pubmed|8206849]
regulation
induced in the absence of uridine nucleotides ([protein|search|PyrR]) [Pubmed|8206849]
regulatory mechanism
[protein|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]: termination, via [wiki|RNA switch], in [regulon|protein:6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1709162], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]→[gene|0197A037D2AF049B295E1DA60187D4614B2BAC51|pyrE]

2024-06-18 17:36:24

ghost

90

3b978222b0b6a5230a2e7701ac35d1e35cc85307

0A8FD5CB6489EDD8CB2074130B763DCAC1F24654

additional information
expression is reduced in motile cells as compared to non-motile cells [pubmed|33782055]
Biological materials
Mutant
BKE15490 (Δ[gene|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE15490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTTCCCCTCTCTT,  downstream forward: _UP4_AATGTGAAAAGAGGAGAAGC
BKK15490 (Δ[gene|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK15490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTTCCCCTCTCTT,  downstream forward: _UP4_AATGTGAAAAGAGGAGAAGC
References
7868607,8206849,12896995,3015959,7840626,6427186,1709162,3937019,17218307,17322189,21663747,33782055

B83462A50FDDD20FE9BD4681824E30AAD10F506B

Page visits: 5523

Time of last update: 2024-06-20 15:40:08

Author of last update: Jstuelk