

[metabolite|aspartate] carbamoyltransferase

Molecular weight
34.02 kDa
Protein length
Gene length
pyrimidine biosynthesis
[metabolite|aspartate] carbamoyltransferase

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0540 (Galperin et al., 2021)

This gene is a member of the following regulons

1,620,476 → 1,621,390
Visit Visit
The protein
Catalyzed reaction/ biological activity
[metabolite|carbamoyl-P] + L-[metabolite|aspartate] --> H+ + [metabolite|N-carbamoyl-L-aspartate] + [metabolite|phosphate] (according to UniProt)
Protein family
ATCase/OTCase family (with [protein|11E7D77EF9439F817C10BF5D9671C5AE66AF06DC|argF], according to UniProt)
[PDB|3R7D] [Pubmed|21663747]
phosphorylation on Ser-303 [Pubmed|17218307]
Additional information
subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
Expression and Regulation
induced in the absence of uridine nucleotides ([protein|search|PyrR]) [Pubmed|8206849]
regulatory mechanism
[protein|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]: termination, via [wiki|RNA switch], in [regulon|protein:6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1709162], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2024-06-18 17:36:24





additional information
expression is reduced in motile cells as compared to non-motile cells [pubmed|33782055]
Biological materials
BKE15490 (Δ[gene|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTTCCCCTCTCTT,  downstream forward: _UP4_AATGTGAAAAGAGGAGAAGC
BKK15490 (Δ[gene|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTTCCCCTCTCTT,  downstream forward: _UP4_AATGTGAAAAGAGGAGAAGC


Page visits: 5566

Time of last update: 2024-07-14 16:14:35

Author of last update: Jstuelk