tig

tig
168

trigger factor (prolyl isomerase)

locus
BSU_28230
Molecular weight
47.00 kDa
pI
4
Protein length
Gene length
function
protein folding
product
trigger factor (prolyl isomerase)
essential
no
ec
5.2.1.8
synonyms
tig, yzzH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0544 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,886,315 2,887,589
Phenotypes of a mutant
delayed spore [wiki|germination] [Pubmed|25661487]
a [gene|B6BF089BDC615205C9E4032380B1F0D5568D7C00|tig] [gene|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|dnaK] double mutant exhibits an aberrant twisted and filamentous cell morphology, as well as decreased tolerance to heat and to cell wall active antibiotics and hydrolytic enzymes, indicative of defects in cell wall integrity [pubmed|36726573]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
[protein]-peptidylproline (=180) --> [protein]-peptidylproline (=0) (according to UniProt)
Protein family
FKBP-type PPIase family (single member, according to UniProt)
[wiki|Domains]
PPIase FKBP-type domain (aa 163-248) (according to UniProt)
Structure
[PDB|2VRH] (the ''E. coli'' trigger factor) [Pubmed|18497744]
[AF|P80698]
Modification
phosphorylated on Arg-45, the phosphorylation interferes with [protein|B6BF089BDC615205C9E4032380B1F0D5568D7C00|tig] binding to ribosomes [Pubmed|31221751]
phosphorylated on Arg-90 [Pubmed|22517742]
phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
Additional information
subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|B6BF089BDC615205C9E4032380B1F0D5568D7C00|tig]
description
[Pubmed|8969504]
regulation
[protein|search|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
regulatory mechanism
stringent response: negative regulation, in [regulon|other_regulator:stringent response|stringent response]
Open in new tab

[gene|B6BF089BDC615205C9E4032380B1F0D5568D7C00|tig]

2024-06-17 07:51:38

ghost

51

53f7095ed528292caaf637168cb2d213ed866408

2549579C371F2DE79092E0D421F6F5BFE732A9FB

Biological materials
Mutant
BKE28230 ([gene|B6BF089BDC615205C9E4032380B1F0D5568D7C00|tig]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE28230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTTTCCCTCCAAAAA, downstream forward: _UP4_TAATATGGTGCATAATAATA
BKK28230 ([gene|B6BF089BDC615205C9E4032380B1F0D5568D7C00|tig]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK28230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTTTCCCTCCAAAAA, downstream forward: _UP4_TAATATGGTGCATAATAATA
References
Reviews
16231086,15763705,15837180,19647435,27890920,28724440
Original Publications
36815589,12226666,12224648,9748346,9063446,18497744,16493705,8969504,20525796,22517742,16271892,16091460,15378759,25661487,31221751,31740237,36726573

B6BF089BDC615205C9E4032380B1F0D5568D7C00

Page visits: 3194

Time of last update: 2024-07-15 05:21:18

Author of last update: Jstuelk