rex

rex
168

transcriptional repressor of anaerobically expressed genes involved in anaerobic respiration and fermentation

locus
BSU_05970
Molecular weight
23.95 kDa
pI
6.77
Protein length
Gene length
function
regulation of fermentation and anaerobic respiration
product
transcriptional repressor
essential
no
synonyms
rex, ydiH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2344 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
647,091 → 647,738
Phenotypes of a mutant
inactivation of ''[gene|B5EF521437323EF43F08E5EFDB5C798616CA499A|rex]'' reduces sporulation efficiency to 9.2% that of wild type cells [Pubmed|26735940]
inactivation of ''[gene|B5EF521437323EF43F08E5EFDB5C798616CA499A|rex]'' confers resistance to high concentrations of Zn(II) [Pubmed|27935957]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Protein family
transcriptional regulatory rex family (single member, according to UniProt)
Structure
[PDB|2VT2],  [PDB|2VT3]
[AF|O05521]
Effectors of protein activity
NADH (indication of low oxygen concentration) releases Rex from DNA [Pubmed|18485070], Rex has a very high affinity for NADH
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|4A8D74B83E20FA138ED66F0D8FD456B69B740D92|ydiG]-[gene|B5EF521437323EF43F08E5EFDB5C798616CA499A|rex]-[gene|780FDF3DD260287428B397FFE7F44DDF1917381C|tatAY]-[gene|E60FC9C9B273DD6B07B7B95819525DE5F35113CE|tatCY]
description
[Pubmed|22383849]
regulation
constitutitvely expressed [Pubmed|22383849]
the mRNA is processed between [gene|B5EF521437323EF43F08E5EFDB5C798616CA499A|rex] and [gene|780FDF3DD260287428B397FFE7F44DDF1917381C|tatAY] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|ricA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|ricF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|ricT] complex [Pubmed|29794222]
Open in new tab

[gene|4A8D74B83E20FA138ED66F0D8FD456B69B740D92|ydiG]→[gene|E60FC9C9B273DD6B07B7B95819525DE5F35113CE|tatCY]

2024-07-01 03:46:23

Jstuelk

55

c85bb146dcdc740e3e21e01dea58cd7fd7dc9315

77618D8DC4FC5B69859BD5D38C3215E1FA8D50DF

Biological materials
Mutant
MGNA-C201 (ydiH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2199 NBRP B. subtilis, Japan]
LUW292 (erm), GP834 (erm), both available in the [wiki|Stülke] lab
BKE05970 (Δ[gene|B5EF521437323EF43F08E5EFDB5C798616CA499A|rex]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE05970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGGAATTTTTGATTGATCCT,  downstream forward: _UP4_TAGAGGGAAAGGAGGAGCCC
BKK05970 (Δ[gene|B5EF521437323EF43F08E5EFDB5C798616CA499A|rex]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK05970 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CGGAATTTTTGATTGATCCT,  downstream forward: _UP4_TAGAGGGAAAGGAGGAGCCC
labs
[wiki|Claes von Wachenfeldt], Lund University, Sweden [http://aron.ldc.lu.se/kundwebb/cellorg/mibiol/research/wachen/index.htm Homepage]
References
Reviews
23046954
Original Publications
16207915,18485070,15231791,17015645,20525796,21402078,22383849,25216269,26735940,27935957,29794222

B5EF521437323EF43F08E5EFDB5C798616CA499A

Page visits: 4054

Time of last update: 2024-07-15 05:24:21

Author of last update: Melvin.boenninger