dusB2

dusB2
168

minor tRNA-dihydrouridine synthase 2

locus
BSU_08030
Molecular weight
36.83 kDa
pI
5.38
Protein length
Gene length
function
tRNA modification
product
tRNA-dihydrouridine synthase 2
essential
no
synonyms
yfjN, dusC, dus2

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0042 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
876,426 → 877,403
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
5,6-dihydrouridine in tRNA + NAD+ → uridine in tRNA + H+ + NADH [Pubmed|38682613]
5,6-dihydrouridine in tRNA + NADP+ → uridine in tRNA + H+ + NADPH [Pubmed|38682613]
Protein family
Dus family (with [protein|CE45D56BC413555AF4E7914B5307AD967A358452|dusB1], according to UniProt)
[wiki|Cofactors]
FMN [Pubmed|38682613]
Structure
[PDB|3B0P] (from Thermus thermophilus, 24% identity, from aa 12 ... 263) [pubmed|22123979]
[AF|O31546]
Paralogous protein(s)
[protein|CE45D56BC413555AF4E7914B5307AD967A358452|dusB1]
Expression and Regulation
Operons
genes
[gene|B1C2BD8CEEABF9BBAE2646E8E24457A485097CFC|dusB2]
description
[Pubmed|29794222]
regulation
the leader mRNA is processed by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|ricA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|ricF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|ricT] complex [Pubmed|29794222]
Open in new tab

[gene|B1C2BD8CEEABF9BBAE2646E8E24457A485097CFC|dusB2]

2024-05-31 02:09:22

Jstuelk

62

533af6490ff87959a5b9e04f2a6ce1d0eeee86a7

90C3E4122ED23B7B59E83D63D26180C99D78E210

Biological materials
Mutant
MGNA-C277 (yfjN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2275 NBRP B. subtilis, Japan]
BKE08030 (Δ[gene|B1C2BD8CEEABF9BBAE2646E8E24457A485097CFC|dusB2]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE08030 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACAAAAATCAAATCCT,  downstream forward: _UP4_TAACAGCAGTGCTTGATTCA
BKK08030 (Δ[gene|B1C2BD8CEEABF9BBAE2646E8E24457A485097CFC|dusB2]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK08030 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACAAAAATCAAATCCT,  downstream forward: _UP4_TAACAGCAGTGCTTGATTCA
References
25902496,22123979,29794222,38682613

B1C2BD8CEEABF9BBAE2646E8E24457A485097CFC

Page visits: 2002

Time of last update: 2024-06-20 17:56:27

Author of last update: Jstuelk