yxjG

yxjG
168

putative B12-independent methionine synthase

locus
BSU_38960
Molecular weight
42.96 kDa
pI
5.01
Protein length
Gene length
function
unknown
product
putative methionine synthase
essential
no
synonyms
yxjG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0620 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,999,350  4,000,486
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Structure
[PDB|1YPX] (the enzyme from ''Listeria monocytogenes'', 49% identity)
[AF|P42318]
Modification
S-bacillithiolation upon hypochlorite stress on Cys-346 [Pubmed|21749987]
Paralogous protein(s)
[protein|55459D8F0BBB2669EB9F25276A17F1A7EB322AF1|yxjH]
Expression and Regulation
Operons
genes
[gene|A866ACE8431EC3FF98ADC734D9322AE699ECBFAD|yxjG]
description
[Pubmed|10746760]
regulation
induced by methionine starvation ([wiki|S-box]) [Pubmed|10094622]
the [wiki|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
S-box: RNA switch, , the [wiki|S-box] [wiki|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|other_regulator:S-box|S-box]
Open in new tab

[gene|A866ACE8431EC3FF98ADC734D9322AE699ECBFAD|yxjG]

2024-06-08 14:04:03

Jstuelk

45

c73b35012c05032f9394aded9af556aba04b6aec

DD172A67E72D799BA6CDE3355BD789009EFA1C46

Biological materials
Mutant
MGNA-B731 (yxjG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1730 NBRP B. subtilis, Japan]
BKE38960 ([gene|A866ACE8431EC3FF98ADC734D9322AE699ECBFAD|yxjG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE38960 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTGTCCATTCCTTCTT,  downstream forward: _UP4_TAAGCAAAGAAAAAAACACA
BKK38960 ([gene|A866ACE8431EC3FF98ADC734D9322AE699ECBFAD|yxjG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK38960 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTGTCCATTCCTTCTT,  downstream forward: _UP4_TAAGCAAAGAAAAAAACACA
References
19258532,10094622,18039762,12107147,21749987,29794222

A866ACE8431EC3FF98ADC734D9322AE699ECBFAD

Page visits: 3630

Time of last update: 2024-06-21 20:11:30

Author of last update: Jstuelk