ktrD

ktrD
168

glutamate-controlled potassium channel [protein|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]-[protein|A0952B75E5BD0D09B0F4C257822428640998558B|ktrD], integral membrane subunit

locus
BSU_13500
Molecular weight
49.26 kDa
pI
9.22
Protein length
Gene length
function
potassium uptake
product
glutamate-controlled potassium channel [protein|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]-[protein|A0952B75E5BD0D09B0F4C257822428640998558B|ktrD], integral membrane subunit
essential
no
synonyms
ktrD, ykrM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0168 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,416,067  1,417,416
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
uptake of potassium
Protein family
TrkH potassium transport family (with [protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB], according to UniProt)
Structure
[PDB|4J7C] (the [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB] complex, 36% identity) [Pubmed|23598340]
[AF|O31658]
Effectors of protein activity
the affinity of [protein|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]-[protein|A0952B75E5BD0D09B0F4C257822428640998558B|ktrD] for potassium is strongly increased in the presence of glutamate [pubmed|32253343]
Kinetic information
the [protein|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]-[protein|search|KtrD ]channel has a low affinity for potassium,this is determined by KtrD [pubmed|30753894]
the affinity of [protein|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]-[protein|A0952B75E5BD0D09B0F4C257822428640998558B|ktrD] for potassium is strongly increased in the presence of glutamate (the KD for potassium is decreased from 0.278 mM to 0.017 mM) [pubmed|32253343]
Paralogous protein(s)
[protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]
[wiki|Localization]
integral membrane protein [Pubmed|12562800]
Expression and Regulation
Operons
genes
[gene|A0952B75E5BD0D09B0F4C257822428640998558B|ktrD]
description
[Pubmed|12562800]
regulation
constitutively expressed
Open in new tab

[gene|A0952B75E5BD0D09B0F4C257822428640998558B|ktrD]

2024-06-20 06:01:01

ghost

96

da2b163f36522f06a6ffa3d1cfa83fe5dbddc9da

37DC89FD9C943F1F483F491C9F41351F4CA8C688

Biological materials
Mutant
MGNA-B317 (ykrM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1316 NBRP B. subtilis, Japan]
GHB12 (''ktrD''::''tet''), [Pubmed|12562800], available in [wiki|Erhard Bremer]'s and [wiki|Jörg Stülke]'s labs
GP2030 (''ktrD''::''tet''), available in  [wiki|Jörg Stülke]'s lab [pubmed|28420751]
GP3646 (''ktrD''::''kan''), available in  [wiki|Jörg Stülke]'s lab
GP4184 (''ktrD''::''spec''), available in  [wiki|Jörg Stülke]'s lab
1A956 (''ktrD''::''tet''), [Pubmed|12562800], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A956&Search=1A956 BGSC]
BKE13500 ([gene|A0952B75E5BD0D09B0F4C257822428640998558B|ktrD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE13500 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTAAAATCCTTCTGCCT,  downstream forward: _UP4_TAGGCAAAACACCGCATATT
BKK13500 ([gene|A0952B75E5BD0D09B0F4C257822428640998558B|ktrD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK13500 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTAAAATCCTTCTGCCT,  downstream forward: _UP4_TAGGCAAAACACCGCATATT
Expression vectors
pGP2996 (N-terminal 6xHis-tag, purification from E. coli, in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
FLAG-tag construct
GP3465 ''ktrD-3xFLAG spc'' (based on [wiki|pGP1331]), available in [wiki|Jörg Stülke]'s lab
labs
[wiki|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi Homepage]
[wiki|Inga Hänelt], Frankfurt, Germany [https://www.biochem.uni-frankfurt.de/index.php?id=298 Homepage]
[wiki|João H Morais-Cabral], University of Porto, Portugal [https://www.i3s.up.pt/research-group?x=47 Homepage]
[wiki|Jörg Stülke], University of Göttingen, Germany [http://genmibio.uni-goettingen.de Homepage]
References
Reviews
21680052,27935846,25838295,33288383
Original Publications
12562800,23598340,28420751,28504641,30753894,32253343,33798529,38652747,38719864,38832794

A0952B75E5BD0D09B0F4C257822428640998558B

Page visits: 3778

Time of last update: 2024-06-20 22:32:57

Author of last update: Jstuelk