ylxS

ylxS
168

similar to ribosome maturation protein

locus
BSU_16590
Molecular weight
17.48 kDa
pI
4.48
Protein length
Gene length
function
ribosome maturation
product
unknown
essential
no
synonyms
ylxS, ymxA, rimP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0779 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,731,776  1,732,246
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Protein family
RimP family (single member, according to UniProt)
Structure
[PDB|1IB8] (from ''Streptococcus pneumoniae'', 41% identity) [Pubmed|11493012]
[AF|P32726]
Expression and Regulation
Operons
genes
[gene|9F6C447900410BF64409E5C41A11C76968DADAFA|ylxS]-[gene|8887ADC77C43F21CD375BDAA4D38E940786DAD4F|nusA]-[gene|F4097349A563503468A2A14F062AEAC532C7917A|rnpM]-[gene|7BFA65857F69855DBB3BB64D93B4ED2F09DC705B|rplGA]-[gene|378B77412D0DEA220A97DEC246410509D9B74D46|infB]-[gene|24835CE6CD2E1F183DB9121F29A63101718B5DF9|ylxP]-[gene|B3119A40393A288EF34FC3E9839B6E40AC6A6EA0|rbfA]
description
[Pubmed|8491709]
regulation
autoregulation [wiki|NusA] [pubmed|27571753]
induced by glucose [pubmed|30355672]
expression is reduced in motile cells as compared to non-motile cells [pubmed|33782055]
regulatory mechanism
stringent response: negative regulation, in [regulon|other_regulator:stringent response|stringent response]
[protein|8887ADC77C43F21CD375BDAA4D38E940786DAD4F|nusA]: attenuation, [protein|8887ADC77C43F21CD375BDAA4D38E940786DAD4F|nusA] stimulates termination [Pubmed|27571753], in [regulon|protein:8887ADC77C43F21CD375BDAA4D38E940786DAD4F|nusA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8491709], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528,26577401], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|9F6C447900410BF64409E5C41A11C76968DADAFA|ylxS]→[gene|B3119A40393A288EF34FC3E9839B6E40AC6A6EA0|rbfA]

2024-07-07 12:22:40

Jstuelk

109

019B939D583142A5395482C3EECB5B469F354080

A30223501809D45C115085980399F87C5C5A0442

Biological materials
Mutant
BKE16590 ([gene|9F6C447900410BF64409E5C41A11C76968DADAFA|ylxS]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE16590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTCCTCCTTGTGC,  downstream forward: _UP4_TAATGAATACAAATGTTTTA
BKK16590 ([gene|9F6C447900410BF64409E5C41A11C76968DADAFA|ylxS]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK16590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTCCTCCTTGTGC,  downstream forward: _UP4_TAATGAATACAAATGTTTTA
References
36815589,11948165,8491709,20525796,19150615,11493012,27120414,33782055

9F6C447900410BF64409E5C41A11C76968DADAFA

Page visits: 4299

Time of last update: 2024-07-13 22:33:30

Author of last update: Jstuelk