

ribosomal protein bS6

Molecular weight
10.99 kDa
Protein length
Gene length
ribosomal protein bS6

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0360 (Galperin et al., 2021)

This gene is a member of the following regulons

4,199,445 4,199,732
Visit Sartorius.com Visit Sartorius.com
The protein
Protein family
bacterial [wiki|ribosomal protein] bS6 family (single member, according to UniProt)
[PDB|3R3T] (from ''Bacillus anthracis'', 71% identity, 97% similarity)
[PDB|3J9W] (the [wiki|ribosome]) [Pubmed|25903689]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
this ribosomal protein is lacking in some organisms with very small genomes [pubmed|33753464]
Expression and Regulation
Open in new tab


2024-07-14 21:57:39





[protein|search|ComK]: transcription activation [Pubmed|11948146]
regulatory mechanism
[protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]: activation, in [regulon|protein:08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK regulon]
stringent response: negative regulation, in [regulon|other_regulator:stringent response|stringent response]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|24310371], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2024-07-14 21:57:40





[protein|search|ComK]: transcription activation [Pubmed|11948146]
Open in new tab


2024-06-20 03:16:00





Biological materials
BKE40910 ([gene|9D25B8F4579C41E77AE9CDD18CAD6DA37F3DD0A2|rpsF]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE40910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTTTGCACCTCCTTT, downstream forward: _UP4_TAAGCAATTTTGAAATATAT
BKK40910 ([gene|9D25B8F4579C41E77AE9CDD18CAD6DA37F3DD0A2|rpsF]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK40910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTTTGCACCTCCTTT, downstream forward: _UP4_TAAGCAATTTTGAAATATAT
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab


Page visits: 5573

Time of last update: 2024-07-24 09:01:34

Author of last update: Jstuelk