rpsF

rpsF
168

ribosomal protein bS6

locus
BSU_40910
Molecular weight
10.99 kDa
pI
4.99
Protein length
Gene length
function
translation
product
ribosomal protein bS6
essential
no
synonyms
rpsF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0360 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
4,199,445 4,199,732
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Protein family
bacterial [wiki|ribosomal protein] bS6 family (single member, according to UniProt)
Structure
[PDB|3R3T] (from ''Bacillus anthracis'', 71% identity, 97% similarity)
[PDB|3J9W] (the [wiki|ribosome]) [Pubmed|25903689]
[AF|P21468]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
this ribosomal protein is lacking in some organisms with very small genomes [pubmed|33753464]
Expression and Regulation
Operons
genes
[gene|BD162A17E5F3F9AB49E478CE72D0FE92D82E6673|yyzM]-[gene|FEE1952DFA3D6A5E2DC108B3B203B526642E2C68|yyaE]-[gene|C0F5FAD6DF89DA9E0FFC8F888D7CED6AA42D9C73|yyaF]-[gene|9D25B8F4579C41E77AE9CDD18CAD6DA37F3DD0A2|rpsF]-[gene|8DE39680CA7663803A107066FBE9AFFCC77DB72A|ssbA]-[gene|C0B926F1134A7A3FEEC886F9AF67F694C8E0C089|rpsR]
description
[Pubmed|22383849]
Open in new tab

[gene|BD162A17E5F3F9AB49E478CE72D0FE92D82E6673|yyzM]→[gene|C0B926F1134A7A3FEEC886F9AF67F694C8E0C089|rpsR]

2024-05-22 03:09:12

Jstuelk

98

9d6f6c8f552e3b902331ccb27a1c555fb109c0c2

9ABCA2D017C483FB4103C07C6AB9E7C773168C9B

genes
[gene|C0F5FAD6DF89DA9E0FFC8F888D7CED6AA42D9C73|yyaF]-[gene|9D25B8F4579C41E77AE9CDD18CAD6DA37F3DD0A2|rpsF]-[gene|8DE39680CA7663803A107066FBE9AFFCC77DB72A|ssbA]-[gene|C0B926F1134A7A3FEEC886F9AF67F694C8E0C089|rpsR]
description
[Pubmed|14762004]
regulation
[protein|search|ComK]: transcription activation [Pubmed|11948146]
regulatory mechanism
[protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK]: activation, in [regulon|protein:08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK regulon]
stringent response: negative regulation, in [regulon|other_regulator:stringent response|stringent response]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|24310371], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|C0F5FAD6DF89DA9E0FFC8F888D7CED6AA42D9C73|yyaF]→[gene|C0B926F1134A7A3FEEC886F9AF67F694C8E0C089|rpsR]

2024-05-16 12:34:38

ghost

109

919e120921039bf82b5f231ffb9cdc8bf1c3e019

AB203DF546C89702CE168BF3D045E792086CFD74

genes
[gene|9D25B8F4579C41E77AE9CDD18CAD6DA37F3DD0A2|rpsF]-[gene|8DE39680CA7663803A107066FBE9AFFCC77DB72A|ssbA]-[gene|C0B926F1134A7A3FEEC886F9AF67F694C8E0C089|rpsR]
description
[Pubmed|24310371,22383849]
regulation
[protein|search|ComK]: transcription activation [Pubmed|11948146]
Open in new tab

[gene|9D25B8F4579C41E77AE9CDD18CAD6DA37F3DD0A2|rpsF]→[gene|C0B926F1134A7A3FEEC886F9AF67F694C8E0C089|rpsR]

2024-05-21 20:36:57

ghost

97

ef3559f814924db6da26c9fc948db5469dce9372

D2E7E6D0BCE6EA5BE943D1C2788FE30058A48877

Biological materials
Mutant
BKE40910 ([gene|9D25B8F4579C41E77AE9CDD18CAD6DA37F3DD0A2|rpsF]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE40910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTTTGCACCTCCTTT, downstream forward: _UP4_TAAGCAATTTTGAAATATAT
BKK40910 ([gene|9D25B8F4579C41E77AE9CDD18CAD6DA37F3DD0A2|rpsF]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK40910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTTTGCACCTCCTTT, downstream forward: _UP4_TAAGCAATTTTGAAATATAT
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
References
36815589,19653700,14762004,11948165,11948146,23002217,22383849,24310371,15378759,25903689,33753464

9D25B8F4579C41E77AE9CDD18CAD6DA37F3DD0A2

Page visits: 5371

Time of last update: 2024-05-23 05:57:47

Author of last update: Jstuelk