coaX

coaX
168

type III [metabolite|pantothenate] kinase

locus
BSU_00700
Molecular weight
26.07 kDa
pI
8.37
Protein length
Gene length
function
biosynthesis of [metabolite|coenzyme A]
product
[metabolite|pantothenate] kinase
essential
no
ec
2.7.1.33
synonyms
coaX, yacB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1521 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
79,092  79,868
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
(R)-[metabolite|pantothenate] + [protein|search|ATP] --> (R)-4'-[metabolite|phosphopantothenate] + [metabolite|ADP] + H+ (according to UniProt)
Protein family
type III pantothenate kinase family (single member, according to UniProt)
[wiki|Cofactors]
requires NH4+ for activity [pubmed|24784177]
Structure
[PDB|2H3G] (from ''Bacillus anthracis str. ames'', 75% identity, 88% similarity) [Pubmed|17323930]
[AF|P37564]
[wiki|Localization]
cytoplasm (according to UniProt)
Expression and Regulation
Operons
genes
[gene|9B8EAD4EDDA97526D4462F6F3205F81FECD039DE|coaX]-[gene|D579A7E4D8C3DEE4F85586C5F721CAD5FE2BCA75|yacC]-[gene|548926987569033AA0C40610B8E80FB2BB8E1E3A|yacD]-[gene|D1FC976597E5583E40A4ED7234FBCA743AB01354|cysK]
description
[Pubmed|22383849]
regulation
induced by heat stress ([protein|2C6386E9A63F410558D168798D077DF91590F454|spx]) [pubmed|30480837]
regulatory mechanism
[protein|2C6386E9A63F410558D168798D077DF91590F454|spx]: activation, [pubmed|30480837], in [regulon|protein:2C6386E9A63F410558D168798D077DF91590F454|spx regulon]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [pubmed|18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
Open in new tab

[gene|9B8EAD4EDDA97526D4462F6F3205F81FECD039DE|coaX]→[gene|D1FC976597E5583E40A4ED7234FBCA743AB01354|cysK]

2024-06-19 00:20:45

Jstuelk

113

9ef1e909d5470f714eecab6c2a37a360ff5a937a

003644EA8BBEA39BF437B882590C41426A16D68B

genes
[gene|9B8EAD4EDDA97526D4462F6F3205F81FECD039DE|coaX]-[gene|D579A7E4D8C3DEE4F85586C5F721CAD5FE2BCA75|yacC]
description
[Pubmed|18179421]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
Open in new tab

[gene|9B8EAD4EDDA97526D4462F6F3205F81FECD039DE|coaX]→[gene|D579A7E4D8C3DEE4F85586C5F721CAD5FE2BCA75|yacC]

2024-06-06 05:37:08

ghost

78

1eddea650a1c473f508201dc69b087c661eb3247

F8A009EE624CB7514C6AD2BA5C39B3D130F9E5CF

Biological materials
Mutant
MGNA-B923 (yacB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1922 NBRP B. subtilis, Japan]
BKE00700 ([gene|9B8EAD4EDDA97526D4462F6F3205F81FECD039DE|coaX]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00700 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACCTCTATCACCACTTTT,  downstream forward: _UP4_GGAAGTGTATAGGAGGTTTA
BKK00700 ([gene|9B8EAD4EDDA97526D4462F6F3205F81FECD039DE|coaX]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00700 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACCTCTATCACCACTTTT,  downstream forward: _UP4_GGAAGTGTATAGGAGGTTTA
GP3356 (''[gene|9B8EAD4EDDA97526D4462F6F3205F81FECD039DE|coaX]''::lox72), available in [wiki|Jörg Stülke]'s lab
GP3381 ([gene|9B8EAD4EDDA97526D4462F6F3205F81FECD039DE|coaX]::neo trpC2), available in [wiki|Jörg Stülke]'s lab
References
15795230,18179421,24784177,17323930

9B8EAD4EDDA97526D4462F6F3205F81FECD039DE

Page visits: 2566

Time of last update: 2024-06-20 08:10:40

Author of last update: Jstuelk