

extracellular polysaccharide synthesis, protein tyrosine kinase, phosphorylation of [protein|5D717F9F54693FD0AA8BC49E10348637858F88B9|epsE]

Molecular weight
24.53 kDa
Protein length
Gene length
biofilm formation
protein tyrosine kinase
epsB, yveL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0489 (Galperin et al., 2021)

This gene is a member of the following regulons

3,528,462  3,529,145
Visit Sartorius.com Visit Sartorius.com
The protein
Catalyzed reaction/ biological activity
phosphorylation of [protein|5D717F9F54693FD0AA8BC49E10348637858F88B9|epsE], to stimulate [protein|5D717F9F54693FD0AA8BC49E10348637858F88B9|epsE] activity and biofilm formation [pubmed|25085422]
ATP + L-tyrosyl-[protein] --> ADP + H+ + O-phospho-L-tyrosyl-[protein] (according to UniProt)
Protein family
BY kinase, see the [http://bykdb.ibcp.fr/BYKdb/BYKdbHelp Bacterial Protein Tyrosine Kinase Database]
CpsD/CapB family (with [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA], according to UniProt)
[PDB|2VED] (CapB, the homolog in ''Staphylococcus aureus'') [Pubmed|18547145]
autophosphorylated on Tyr-225 and Tyr-227 [Pubmed|25085422]
Paralogous protein(s)
Expression and Regulation
repressed by [protein|search|SinR] [Pubmed|15661000]
regulatory mechanism
[protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]: activation, [Pubmed|23646920], in [regulon|protein:6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]) [Pubmed|23646920], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
EAR riboswitch: processive antitermination, in [regulon|other_regulator:EAR riboswitch|EAR riboswitch]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15661000], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
induction by sequestration of [protein|search|SinR] by [protein|search|SinI] or [protein|search|SlrA] [PubMed|15661000,19788541]
Open in new tab


2024-06-09 03:22:36





Biological materials
MGNA-A072 (yveL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/72 NBRP B. subtilis, Japan]
GP1518 (aphA3) [Pubmed|24493247], available in [wiki|Jörg Stülke]'s lab
GP1519 (''[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]-[gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]'', aphA3) [Pubmed|24493247], available in [wiki|Jörg Stülke]'s lab
BKE34360 ([gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE34360 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTTTTTTCTAAAGATCACTC,  downstream forward: _UP4_TAGTTTTTGTAAAGGTGATG
BKK34360 ([gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK34360 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CTTTTTTCTAAAGATCACTC,  downstream forward: _UP4_TAGTTTTTGTAAAGGTGATG
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]) [Pubmed|24493247], available in [wiki|Jörg Stülke]'s lab
FLAG-tag construct
GP1541 epsB-FLAG 3x spc (based on [wiki|pGP1331]) available in [wiki|Jörg Stülke]'s lab
[wiki|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]
Original Publications


Page visits: 5226

Time of last update: 2024-07-16 01:26:50

Author of last update: Melvin.boenninger