pelC

pelC
168

pectate lyase C

locus
BSU_34950
Molecular weight
24.13 kDa
pI
9.14
Protein length
Gene length
function
degradation of polygalacturonic acid
product
pectate lyase C
essential
no
ec
4.2.2.2
synonyms
pelC, yvpA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,590,603  3,591,268
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
Eliminative cleavage of (1->4)-alpha-D-galacturonan to give oligosaccharides with 4-deoxy-alpha-D-galact-4-enuronosyl groups at their non-reducing ends (according to UniProt)
Protein family
polysaccharide lyase 3 family (single member, according to UniProt)
Structure
[PDB|1EE6] (from Bacillus sp., 58% identity) [pubmed|11717490]
[AF|O34310]
[wiki|Localization]
extracellular (signal peptide) [Pubmed|18957862]
Expression and Regulation
Operons
genes
[gene|950D355D993DF79AD5288A00AA04A775637AC04D|yvpB]-[gene|99ECA1B305145A63BD3A72094EF24F56D875BCC1|pelC]
description
[Pubmed|22383849]
Open in new tab

[gene|950D355D993DF79AD5288A00AA04A775637AC04D|yvpB]→[gene|99ECA1B305145A63BD3A72094EF24F56D875BCC1|pelC]

2024-07-14 03:39:12

Jstuelk

54

6f70fbd50aefc530dec3424a93521b29bc4bd1f1

9B6AEABE2297AC3313F1E9D63B1D5AEE8181DA4B

Biological materials
Mutant
MGNA-A382 (yvpA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/382 NBRP B. subtilis, Japan]
BKE34950 ([gene|99ECA1B305145A63BD3A72094EF24F56D875BCC1|pelC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE34950 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGATAAATCCTCCCCGG,  downstream forward: _UP4_TTTTAACAAAAAAAGTCCGC
BKK34950 ([gene|99ECA1B305145A63BD3A72094EF24F56D875BCC1|pelC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK34950 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGATAAATCCTCCCCGG,  downstream forward: _UP4_TTTTAACAAAAAAAGTCCGC
References
18957862,16514142,20525796,24236123,11717490

99ECA1B305145A63BD3A72094EF24F56D875BCC1

Page visits: 4350

Time of last update: 2024-07-15 03:28:11

Author of last update: Melvin.boenninger