yvgN

yvgN
168

glyoxal reductase, general stress protein

locus
BSU_33400
Molecular weight
31.51 kDa
pI
5.07
Protein length
Gene length
function
unknown
product
glyoxal reductase
essential
no
ec
1.1.1.283
synonyms
yvgN, yvsB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0656 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,426,749  3,427,579
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
Lactaldehyde + NADP+ --> methylglyoxal + NADPH (according to UniProt)
Protein family
[wiki|Aldo/keto reductase family] (according to UniProt)
[wiki|Cofactors]
NADP+ [pubmed|31165224]
Structure
[PDB|3B3E] [Pubmed|19585557]
[AF|O32210]
Paralogous protein(s)
[protein|DE12190315DADF13DA1BA272924729BBF909B1D9|ytbE]
Expression and Regulation
Operons
genes
[gene|994D5A36AECC75F5D0B59F7755BC5DB935ED6CE8|yvgN]
description
[pubmed|22383849]
regulatory mechanism
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, [Pubmed|16430695], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|994D5A36AECC75F5D0B59F7755BC5DB935ED6CE8|yvgN]

2024-07-14 20:02:10

Bzhu

60

19d2ff2f28fe21e122264a5e8853000aa7cece50

30831A4E53CE1E876F1BE4DD2EABF33EFB331191

Biological materials
Mutant
MGNA-B061 (yvgN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1060 NBRP B. subtilis, Japan]
BKE33400 ([gene|994D5A36AECC75F5D0B59F7755BC5DB935ED6CE8|yvgN]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE33400 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTGAACCTCCACCCTTT,  downstream forward: _UP4_TAATCAAAAAACTCCCCGTT
BKK33400 ([gene|994D5A36AECC75F5D0B59F7755BC5DB935ED6CE8|yvgN]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK33400 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACTTGAACCTCCACCCTTT,  downstream forward: _UP4_TAATCAAAAAACTCCCCGTT
References
16232966,16430695,19585557,15805528,31165224

994D5A36AECC75F5D0B59F7755BC5DB935ED6CE8

Page visits: 5149

Time of last update: 2024-07-15 04:50:21

Author of last update: Melvin.boenninger