

S protein of tryptophan [wiki|ECF transporter]

Molecular weight
18.13 kDa
Protein length
Gene length
tryptophan uptake
S protein of tryptophan [wiki|ECF transporter]
trpP, yhaG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

1,074,646  1,075,164
Visit Visit
The protein
Protein family
vitamin uptake transporter (VUT/ECF) (TC 2.A.88) family (with [protein|9685A380F95F1A73A693B53E4D35A1CB51043FEC|thiT] and [protein|7DD4BB8222B2EFE81C32C5521A29256095B9D6C1|ypdP], according to UniProt)
cell membrane (according to UniProt)
Expression and Regulation
induced in the absence of tryptophan ([protein|search|MtrB]) [Pubmed|10735881]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10735881], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2024-07-08 15:17:44





Open in new tab


2024-07-05 14:36:44





Other regulations
[protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]: translation inhibition, at an [wiki|RNA switch], the [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB] binding site overlaps the Shine-DAlgarno sequence and translation initation region, [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB] binds in the presence of tryptophan [Pubmed|10735881]
Biological materials
GP4788 (trpC2 Δ[gene|97573C2D4FD8BE6B4C749C0644D053C9A0CBFFF3|trpP]::neo), available in [wiki|Jörg Stülke]'s lab
MGNA-A686 (yhaG::erm), available at the [ NBRP B. subtilis, Japan]
BKE10010 ([gene|97573C2D4FD8BE6B4C749C0644D053C9A0CBFFF3|trpP]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACTATGCTCTCCTCTG,  downstream forward: _UP4_TAATTGTCACACAAAACCTC
BKK10010 ([gene|97573C2D4FD8BE6B4C749C0644D053C9A0CBFFF3|trpP]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACTATGCTCTCCTCTG,  downstream forward: _UP4_TAATTGTCACACAAAACCTC
Original Publications


Page visits: 4129

Time of last update: 2024-07-15 00:26:17

Author of last update: Robert.warneke