yqeH

yqeH
168

assembly/ stability of the 30S subunit of the ribosome, assembly of the 70S ribosome

locus
BSU_25670
Molecular weight
40.84 kDa
pI
6.01
Protein length
Gene length
function
ribosome assembly
product
GTPase
essential
no
synonyms
yqeH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1161 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,645,490  2,646,590
Phenotypes of a mutant
essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
defective in 16S rRNA 3' processing by [protein|E0437C86E5F3707FF1DA13C8B98F73130DED8FB4|yqfG] [pubmed|31003868]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
Binds and hydrolyzes [metabolite|GTP] and readily exchanges [metabolite|GDP] for [metabolite|GTP]
Protein family
TRAFAC class YlqF/YawG GTPase family (together with [protein|54CD247926F7FABE4ACE85EB7021B62500B47260|rbgA] and [protein|519D4694B2895EE6F0D38D918F52F27734506848|cpgA], according to UniProt)
[wiki|Domains]
CP-type G domain (aa 59-222) (according to UniProt)
Structure
[PDB|3EC1] (Geobacillus stearothermophilus) [pubmed|18801747]
[AF|P54453]
Paralogous protein(s)
[protein|9F6B78C1932FB56F7F71430DB16BC862A312407B|ynbA], [protein|B2270316642C66BC2DA86EBDCD1BF6A33CC6A1DC|engA], [protein|C0F5FAD6DF89DA9E0FFC8F888D7CED6AA42D9C73|yyaF], [protein|CB68B3393CA7862C45C624AF7B1ADD188243A01F|era], [protein|DF1A043F3D9817D9479B8C707F4ACEEF2BF2862C|ysxC], [protein|54CD247926F7FABE4ACE85EB7021B62500B47260|rbgA], [protein|66A6EC4F6CB91EE741BB9D7646913FF3EE602BD7|thdF], [protein|84E7D672DB40B114DC4D96A4D8834958B47401A7|obg]
Expression and Regulation
Operons
genes
[gene|722FD63050EED803C859FFD61338C02D5BB4CC1C|yqeG]-[gene|959C0ED7B9DA50F0EADCF1565405B878D36DA206|yqeH]-[gene|776D79C45DADA631D4A75B0773CFF471A87D9EEC|aroD]-[gene|7774FC36BAEAD33EDD48CB77DA0B5E7E0EA38CA2|yqeI]-[gene|AA4BB1F5B58371D536A6BBA86F6ECB5E5BFB12A8|nadD]-[gene|247C47AC70A0EA53E625871D9BC463A06E6B05FB|yqeK]-[gene|B9D5E9B566D28423232C1A28C966CDEA0E5A6B78|yqeL]-[gene|7F63251ABC07F6C11C57B62CBB948240B08D0181|yqeM]
description
[Pubmed|22383849]
expression
expression is increased upon depletion of depletion of tRNA maturation factors [gene|57A79AAF00243B5E058FA901D43AA7B55CA33F63|rnpB] or [gene|C40C5D35ED53D343C8200248FCCB010BAB388054|rnz] [pubmed|36840557]
Open in new tab

[gene|722FD63050EED803C859FFD61338C02D5BB4CC1C|yqeG]→[gene|7F63251ABC07F6C11C57B62CBB948240B08D0181|yqeM]

2024-06-20 10:45:21

Jstuelk

94

16D917C7583868297F7E4E92450A5FA00BB1FF6D

20160DA9FBD3CC875D87545DE18F83BF8B1D0550

Biological materials
Mutant
BKE25670 ([gene|959C0ED7B9DA50F0EADCF1565405B878D36DA206|yqeH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE25670 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTACTCCTCCCACT,  downstream forward: _UP4_ATTTAAGAAAAGGGGAGAGG
BKK25670 ([gene|959C0ED7B9DA50F0EADCF1565405B878D36DA206|yqeH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK25670 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTACTCCTCCCACT,  downstream forward: _UP4_ATTTAAGAAAAGGGGAGAGG
labs
[wiki|Naotake Ogasawara], Nara, Japan
References
Reviews
19575570,21885683
Original Publications
12427945,20376346,19540197,17895579,17237168,22383849,28189581,18801747,31003868,36840557

959C0ED7B9DA50F0EADCF1565405B878D36DA206

Page visits: 2646

Time of last update: 2024-06-20 19:38:27

Author of last update: Jstuelk