argG

argG
168

argininosuccinate synthase, reversible

locus
BSU_29450
Molecular weight
44.66 kDa
pI
5.03
Protein length
Gene length
function
biosynthesis of arginine
product
argininosuccinate synthase, reversible
essential
no
ec
6.3.4.5
synonyms
argG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0137 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,013,133 3,014,344
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
ATP + L-aspartate + L-citrulline --> 2-(N-L-arginino)succinate + AMP + diphosphate + H+ (according to UniProt)
Protein family
argininosuccinate synthase family (single member, according to UniProt)
Structure
[PDB|1KH1] (from ''Thermus thermophilus'', 44% identity, 65% similarity) [Pubmed|11844799]
[AF|O34347]
Modification
S-cysteinylation after diamide stress (C187) [Pubmed|17611193]
phosphorylated on Arg-262 [Pubmed|22517742]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|94E5DA4F460FBC02A186D1013C581179F13BCB3E|argG]-[gene|571789ADA1F7B9DE0F9E205E2DEB9C9166F6C312|argH]
description
[Pubmed|22383849]
regulation
repressed by arginine ([protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC])
induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|rnpM] [pubmed|30355672]
regulatory mechanism
[protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]: repression, in [regulon|protein:62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC regulon]
[protein|F4097349A563503468A2A14F062AEAC532C7917A|rnpM]: unknown, [pubmed|30355672], in [regulon|protein:F4097349A563503468A2A14F062AEAC532C7917A|rnpM regulon]
Open in new tab

[gene|94E5DA4F460FBC02A186D1013C581179F13BCB3E|argG]→[gene|571789ADA1F7B9DE0F9E205E2DEB9C9166F6C312|argH]

2024-05-22 06:09:16

Jstuelk

64

1c207e814f33fb3d04dcc49c4c9da5b8d9da0a69

F891D79BBED99BE9F3E6174F94CE2EF8EDC02509

Biological materials
Mutant
GP1688 ([gene|94E5DA4F460FBC02A186D1013C581179F13BCB3E|argG]-[gene|571789ADA1F7B9DE0F9E205E2DEB9C9166F6C312|argH])::''aphA3'', available in [wiki|Jörg Stülke]'s lab
GP3711 ([gene|94E5DA4F460FBC02A186D1013C581179F13BCB3E|argG]::aphA3 trpC2) available in the [wiki|Stülke] lab
GP3984 ([gene|DE4857E8A228F145EFB9B7AD817585258344ED1F|amyE]::PargGH-lacZ-aphA3) suitable for quantification of expression of the argGH operon, available in [wiki|Jörg Stülke]'s lab
BKE29450 ([gene|94E5DA4F460FBC02A186D1013C581179F13BCB3E|argG]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE29450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAAAAATCCCCTCTC, downstream forward: _UP4_GCATGAAGAAGCTTTGGGGA
BKK29450 ([gene|94E5DA4F460FBC02A186D1013C581179F13BCB3E|argG]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK29450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAAAAATCCCCTCTC, downstream forward: _UP4_GCATGAAGAAGCTTTGGGGA
Expression vectors
pGP3766: expression of Strep-''argG'' by [wiki|pGP380] in ''B. subtilis'' suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
pGP3778: IPTG inducible expression, purification in ''E. coli'' with N-terminal Strep-tag, in [wiki|pGP172], available in [wiki|Jörg Stülke]'s lab
lacZ fusion
GP3984 (aphA3, based on [wiki|pAC7]]), available in [wiki|Jörg Stülke]'s lab
References
17611193,22517742,12107147,22383849,15378759,28516784,11844799

94E5DA4F460FBC02A186D1013C581179F13BCB3E

Page visits: 5278

Time of last update: 2024-05-22 18:00:00

Author of last update: Robert.warneke