

sirohydrochlorin ferrochelatase

Molecular weight
28.69 kDa
Protein length
Gene length
siroheme biosynthesis, sulfite reduction
sirohydrochlorin ferrochelatase
sirB, ylnE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2138 (Galperin et al., 2021)

This gene is a member of the following regulons

1,634,837  1,635,622
Visit Visit
The protein
Catalyzed reaction/ biological activity
insertion of Fe2+ into the substrate sirohydrochlorin (SHC) in siroheme biosynthesis [pubmed|30778451]
2 H+ + siroheme --> Fe2+ + sirohydrochlorin (according to UniProt)
Protein family
CbiX family (single member, according to UniProt)
Apo-form: [PDB|5ZT8] [pubmed|30778451]
Co2+ bound: [PDB|5ZT7] ([pubmed|30778451]), [PDB|6JV6]
Ni2+ bound: [PDB|5ZT9]
Fe3+ bound: [PDB|5ZTA]
Expression and Regulation
induced by methionine starvation ([wiki|S-box]) [Pubmed|10094622]
the [wiki|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
[protein|50930C56C27D22715620A350220E3C56ADB41020|cymR]: transcription repression, [pubmed|], in [regulon|protein:50930C56C27D22715620A350220E3C56ADB41020|cymR regulon]
S-box: RNA switch, , the [wiki|S-box] [wiki|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|other_regulator:S-box|S-box]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|11004190], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2024-06-15 13:50:06





Biological materials
MGNA-B369 (ylnE::erm), available at the [ NBRP B. subtilis, Japan]
BKE15620 ([gene|9349C4646A56F933041EBE750F1BE86BAE7A60D9|sirB]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATATAAAATTGCTTGTTTCA,  downstream forward: _UP4_CAATTTGATTTTGATGGAGG
BKK15620 ([gene|9349C4646A56F933041EBE750F1BE86BAE7A60D9|sirB]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATATAAAATTGCTTGTTTCA,  downstream forward: _UP4_CAATTTGATTTTGATGGAGG


Page visits: 2929

Time of last update: 2024-06-21 00:33:06

Author of last update: Melvin.boenninger