ktrA

ktrA
168

high affinity potassium channel [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB], peripheric membrane component

locus
BSU_31090
Molecular weight
24.73 kDa
pI
5.98
Protein length
Gene length
function
potassium uptake
product
high affinity potassium channel [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB], peripheric membrane component
essential
no
synonyms
ktrA, yuaA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0569 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,188,414  3,189,082
Phenotypes of a mutant
a [gene|search|kimA ][gene|search|ktrA ][gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB] mutant requires high potassium concentrations on minimal medium with ammonium as nitrogen source [pubmed|28420751,28679749]
a [gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB] mutant of ''B. subtilis'' NCIB3610 is reduced in sliding (dendritic spreading)
a [gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA] [gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB] double mutant is unable to adapt to the presence of 1.2 M NaCl [pubmed|35164567][Pubmed|16321950]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
high-affinity uptake of K+ (in complex with [protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB])
Protein family
KtrA potassium transport family (with [protein|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC], according to UniProt)
[wiki|Domains]
contains a [wiki|RCK_N domain] at the N-terminus (aa 8-130) (according to [http://www.uniprot.org/uniprot/?query=RCK+N-terminal+domain&sort=score UniProt])
contains a [wiki|RCK_C domain] at the C-terminus (aa 139-222) (according to [http://www.uniprot.org/uniprot/?query=RCK+C-terminal+domain&sort=score UniProt])
[wiki|Cofactors]
Mg2+ (cofactor in the nucleotide-dependent activation of [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB] by binding at the intra-dimer [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA] interface site) [pubmed|31868587]
Na+, binds at the [metabolite|ATP]-[protein|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA] intra-dimer interface, stabilizes the [metabolite|ATP]-bound [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB] complex and enhances K+ flux activity [pubmed|38719864]
Structure
[PDB|4J7C] (the [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB] complex) [Pubmed|23598340]
[PDB|8K1T] (the [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB] complex in [metabolite|ATP]-bound state with addition of MgCl2) [pubmed|38719864]
[PDB|8K1S] (the [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB] complex in [metabolite|ADP]-bound state) [pubmed|38719864]
[PDB|8K1K] ([protein|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA] with [metabolite|ATP] and sodium [pubmed|38719864]
[PDB|4XTT] (the ''S. aureus'' KtrA [wiki|RCK_C domain] in complex with c-di-AMP, 48% identity) [Pubmed|25957408]
[PDB|1LSU] (complex with NADH)
[http://www.proteopedia.org/wiki/index.php/2hmw 2HMW] ( complex with ATP)
[AF|O32080]
Effectors of protein activity
binds [metabolite|ADP] and [metabolite|ATP] [pubmed|26771197]
activity is inhibited upon binding of [metabolite|c-di-AMP] [pubmed|30753894,31061098]
Na+ binding at the [metabolite|ATP]-[protein|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA] intra-dimer interface stabilizes the [metabolite|ATP]-bound [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB] complex and enhances K+ flux activity [pubmed|38719864]
Kinetic information
the [protein|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB] channel has a high affinity for potassium, this is determined by [protein|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB] [pubmed|30753894]
Paralogous protein(s)
[protein|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]
[wiki|Localization]
peripheral membrane protein [Pubmed|12562800]
Expression and Regulation
Operons
genes
[gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]
description
[Pubmed|12562800]
regulatory mechanism
c-di-AMP Riboswitch: RNA switch, expression is switched off upon binding of c-di-AMP, in [regulon|other_regulator:c-di-AMP Riboswitch|c-di-AMP Riboswitch]
Open in new tab

[gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]→[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]

2024-06-08 06:40:09

ghost

114

26a6fe341a783d36d890ffc444805dfdfe1546b2

0D50A42396785200FADF8E4BEF6B3A6058277227

additional information
growth at extreme potassium limitation results in the acquisition of promoter mutations with increased [gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB] expression [pubmed|28679749]
Biological materials
Mutant
GP4143 ([gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]::lox72 trpC2), available in [wiki|Jörg Stülke]'s lab
GP4145 ([gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]::neo trpC2), available in [wiki|Jörg Stülke]'s lab
MGNA-B543 (yuaA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1542 NBRP B. subtilis, Japan]
1A954 ( ''ktrA''::''kan''), [Pubmed|12562800], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A954&Search=1A954 BGSC]
GHB1 ([gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::''aphA3''), available in [wiki|Erhard Bremer]'s lab
GP92 ([gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::''aphA3''), available in [wiki|Jörg Stülke]'s lab [pubmed|28420751]
GP2083 ([gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::''aphA3'' [gene|15F9BF08762D28CBCD3D9748EFBD29B0D6FD7623|ktrC]::''tet''), available in [wiki|Jörg Stülke]'s lab [pubmed|28420751]
GP2498 ([gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::''spc'' [gene|5968E6D4D7378C69EC3E1E05B285069123AA1FD3|kimA]::''cat''), available in [wiki|Jörg Stülke]'s lab
BKE31090 ([gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE31090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGTTCATATCTCCCTTA,  downstream forward: _UP4_GAAAACGAAGGGATGTAGAC
BKK31090 ([gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK31090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGTTCATATCTCCCTTA,  downstream forward: _UP4_GAAAACGAAGGGATGTAGAC
GP2716 ([gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]-[gene|A287B9771A56D03ADCA603C1969CBF03DCB10E95|ktrB]::''spc''), available in [wiki|Jörg Stülke]'s lab [pubmed|32253343]
GP3065 ([gene|92D0275E0768780F782F4B3724BC5181E436B6B1|ktrA]::''kan''), available in [wiki|Jörg Stülke]'s lab [pubmed|32253343]
Expression vectors
pGP2594: (IPTG inducible expression, purification in ''E. coli'' with N-terminal His-tag, in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
pGP3713: expression of ''ktrA'' (''gapA'' RBS) by [wiki|pBQ200] in ''B. subtilis'', available in [wiki|Jörg Stülke]'s lab
lacZ fusion
GP2176 (based on [wiki|pAC5]), available in [wiki|Jörg Stülke]'s lab
GP2177 (based on [wiki|pAC7]), available in [wiki|Jörg Stülke]'s lab
GP2299 (based on [wiki|pAC6]), available in [wiki|Jörg Stülke]'s lab [pubmed|28679749]
labs
[wiki|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi Homepage]
[wiki|Inga Hänelt], Frankfurt, Germany [https://www.biochem.uni-frankfurt.de/index.php?id=298 Homepage]
[wiki|João H Morais-Cabral], University of Porto, Portugal [https://www.i3s.up.pt/research-group?x=47 Homepage]
[wiki|Jörg Stülke], University of Göttingen, Germany [http://genmibio.uni-goettingen.de Homepage]
References
Reviews
25869574,27935846,28086088,28825218,25838295,31361596,32095817,32603625,33798529,33288383
Original Publications
12562800,15096624,16321950,20511502,23086297,23598340,24141192,25957408,16990138,26771197,28086091,28420751,28504641,28679749,30753894,31061098,31868587,32253343,33732218,35164567,38652747,38719864

92D0275E0768780F782F4B3724BC5181E436B6B1

Page visits: 6263

Time of last update: 2024-06-20 10:14:57

Author of last update: Jstuelk