slrR

slrR
168

transcriptional activator ([wiki|Xre family]) of competence development and [wiki|sporulation] genes, represses [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]-dependent flagellar genes, antagonist of [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|slrA] and [protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR], has LexA-like autocleavage activity

locus
BSU_34380
Molecular weight
17.43 kDa
pI
9.63
Protein length
Gene length
function
regulation of initiation of [wiki|biofilm formation] and of autolysis
product
transcriptional regulator ([wiki|Xre family]), [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|slrA] antagonist
essential
no
synonyms
slrR, yveJ, slr

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1396 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,530,101  3,530,559
Phenotypes of a mutant
smooth colonies on MsGG medium, no [wiki|biofilm formation] [Pubmed|22113911]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
[protein|920F91E748EE079FF864011D9052B073567C41E4|slrR] binds to and inhibits the activity of [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|slrA], [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|slrA] indirectly stimulates the synthesis of [protein|920F91E748EE079FF864011D9052B073567C41E4|slrR] by interacting with [protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]. [protein|920F91E748EE079FF864011D9052B073567C41E4|slrR] can bind to [protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR] and [protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR] directly represses the transcription of [protein|920F91E748EE079FF864011D9052B073567C41E4|slrR]. [protein|920F91E748EE079FF864011D9052B073567C41E4|slrR] indirectly derepresses its own gene. The heterocomplex of [protein|920F91E748EE079FF864011D9052B073567C41E4|slrR]-[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR] is a repressor of autolysin and motility genes and inhibits the repressor function of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR].   [Pubmed|19788541,20923420,20351052]
repression of transcription of  ''[gene|497C9654DC7514FF738D18E1F083299C43003A4C|lytA]-[gene|E1F9922DF7273040F84E5AC207A9F4CAFB85DC75|lytB]-[gene|6A21293823151C6980BF52B31A4B249A8440F2E1|lytC]'' and ''[gene|E8B88CBE4F9121DFEEF099D7947CD1E1AE656160|lytF]'' [Pubmed|20351052]
autocleavage [Pubmed|20923420]
Protein family
[wiki|Xre family]
[wiki|Domains]
[wiki|HTH cro/C1-type domain] (aa 6-61) (according to UniProt)
[wiki|Sin domain] (aa 113-151) (according to UniProt)
Structure
[AF|P71049]
Modification
subject to self-cleavage via a LexA-like autopeptidase, this involves [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC] and requires [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU] [Pubmed|26819068,20923420]
Effectors of protein activity
interaction with [protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR] triggers binding of SlrR to the promoters of ''[gene|497C9654DC7514FF738D18E1F083299C43003A4C|lytA]-[gene|E1F9922DF7273040F84E5AC207A9F4CAFB85DC75|lytB]-[gene|6A21293823151C6980BF52B31A4B249A8440F2E1|lytC]'' and ''[gene|E8B88CBE4F9121DFEEF099D7947CD1E1AE656160|lytF]'', resulting in their repression [Pubmed|20351052]
Paralogous protein(s)
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]
Expression and Regulation
Operons
genes
[gene|920F91E748EE079FF864011D9052B073567C41E4|slrR]-[gene|7FCB9037FDDC176FCF76088ADE7387A6A37068A9|pnbA]
description
[Pubmed|21815947]
regulatory mechanism
[protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|abh]: activation, [Pubmed|19767430], in [regulon|protein:5872812AB61E92E2944E926915EB7FEE71BFA6D5|abh regulon]
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, [Pubmed|19788541], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
additional information
induction by sequestration of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR] by [protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|sinI], [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|slrA] [PubMed|15661000,19788541] or by SlrR itself [PubMed|20351052]
Open in new tab

[gene|920F91E748EE079FF864011D9052B073567C41E4|slrR]->[gene|7FCB9037FDDC176FCF76088ADE7387A6A37068A9|pnbA]

2024-07-03 12:55:14

Jstuelk

84

3358c5e18cdab4c493893062172b97a17de9a83a

95EEFC91581CAC91E7EB53DE46FEEBE061AAC2B5

Biological materials
Mutant
MGNA-A089 (slr::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/89 NBRP B. subtilis, Japan]
GP955 (''slrR''-''[gene|7FCB9037FDDC176FCF76088ADE7387A6A37068A9|pnbA]''::''cat''), available in [wiki|Jörg Stülke]'s lab
BKE34380 ([gene|920F91E748EE079FF864011D9052B073567C41E4|slrR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE34380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAATATGAAATTCTCCTC,  downstream forward: _UP4_TGATGATCGGTTAAAGGGCT
BKK34380 ([gene|920F91E748EE079FF864011D9052B073567C41E4|slrR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK34380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAATATGAAATTCTCCTC,  downstream forward: _UP4_TGATGATCGGTTAAAGGGCT
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in [wiki|Jörg Stülke]'s lab
References
Reviews
20541494,23353768,24988880
Original Publications
23378512,23430750,21856853,22329926,22113911,20817675,18430133,18647168,19767430,19788541,20351052,20923420,24256735,26819068,28546427,31604312,34232062,36786593,38088582

920F91E748EE079FF864011D9052B073567C41E4

Page visits: 7073

Time of last update: 2024-07-15 00:18:30

Author of last update: Jstuelk