mtnX

mtnX
168

2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase

locus
BSU_13600
Molecular weight
26.85 kDa
pI
4.66
Protein length
Gene length
function
methionine salvage
product
2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase
essential
no
synonyms
mtnX, ykrX

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4359 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,428,275  1,428,982
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
2-hydroxy-5-methylsulfanyl-3-oxopent-1-enyl phosphate + H2O --> 1,2-dihydroxy-5-(methylsulfanyl)pent-1-en-3-one + phosphate (according to UniProt)
Protein family
[wiki|HAD superfamily] (according to UniProt)
Structure
[PDB|2FEA] [pubmed|17654724]
[AF|O31667]
Expression and Regulation
Operons
genes
[gene|42D2F9B958F62DFE447A1321E4109D676ECB899C|mtnW]-[gene|91633E6AF9A715166AE05BD7E540463DE352AA20|mtnX]-[gene|337F1E27C2E380DF8DCADE3581F74CFF52AFD224|mtnB]-[gene|C7D9E701B2CA2C9E85D69CAD6E0A45BE590BAED9|mtnD]
description
[Pubmed|12022921]
regulation
induced by methionine starvation ([wiki|S-box]) [Pubmed|10094622]
regulatory mechanism
S-box: RNA switch, , the [wiki|S-box] [wiki|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|other_regulator:S-box|S-box]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|12022921], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|42D2F9B958F62DFE447A1321E4109D676ECB899C|mtnW]→[gene|C7D9E701B2CA2C9E85D69CAD6E0A45BE590BAED9|mtnD]

2024-06-20 06:43:32

Jstuelk

57

a2b13ba83890892f9d8595d5e452be227045e93c

6416B0A5CDDC144986D3159AFC5B04D4507F2AE1

Biological materials
Mutant
MGNA-A785 (ykrX::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/785 NBRP B. subtilis, Japan]
BKE13600 ([gene|91633E6AF9A715166AE05BD7E540463DE352AA20|mtnX]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE13600 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATAATAAAAGGTTTTCGAG,  downstream forward: _UP4_GAGAATGTAAAGGAGGTACA
BKK13600 ([gene|91633E6AF9A715166AE05BD7E540463DE352AA20|mtnX]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK13600 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATAATAAAAGGTTTTCGAG,  downstream forward: _UP4_GAGAATGTAAAGGAGGTACA
References
12022921,11914366,12107147,15102328,12787499,18039762,17654724

91633E6AF9A715166AE05BD7E540463DE352AA20

Page visits: 2806

Time of last update: 2024-06-21 19:10:53

Author of last update: Melvin.boenninger