bglH

bglH
168

phospho-beta-glucosidase

locus
BSU_39260
Molecular weight
53.12 kDa
pI
4.96
Protein length
Gene length
function
salicin utilization
product
phospho-beta-glucosidase
essential
no
ec
3.2.1.86
synonyms
bglH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2723 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
4,032,346  4,033,755
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
6-phospho-β-D-glucosyl-(1→4)-D-glucose + H2O --> D-glucose + D-glucose 6-phosphate (according to UniProt)
Protein family
[wiki|glycosyl hydrolase 1 family] (according to UniProt)
Structure
[PDB|4IPL] (from ''Streptococcus pneumoniae'', 60% identity) [Pubmed|23580646]
[AF|P40740]
Expression and Regulation
Operons
genes
[gene|35E6C81BE481C3E57CF47B781580368C3AC15D83|bglP]-[gene|8D98212930CF6613D332BF99452B231CB6426E93|bglH]-[gene|5A4CDE1CFE319E4471A15702ED1632C96270528D|yxiE]
description
[Pubmed|7883710]
regulation
induced by salicin ([protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT]) [Pubmed|7883710]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA] binding site overlaps -35 region) [Pubmed|7559347], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT]: anti-termination, via [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT]-dependent [wiki|RNA switch], lack of [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT]-dependent antitermination in the presence of gucose due to the requirement of [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT] to be phosphorylated by [protein|771F205F818A755A661B8E1C95365A4F6AEB05C7|hprK], in [regulon|protein:FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7559347], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
An [wiki|ncRNA] is predicted for '[protein|35E6C81BE481C3E57CF47B781580368C3AC15D83|bglP]' [PubMed|20525796]
Open in new tab

[gene|35E6C81BE481C3E57CF47B781580368C3AC15D83|bglP]→[gene|5A4CDE1CFE319E4471A15702ED1632C96270528D|yxiE]

2024-07-02 15:22:30

TPed

87

3430E959FA22F9ED02C53C45C680D768C53B97DA

8A72165F04B8ECFE717CF8873DBC92B33D203CC9

Biological materials
Mutant
BKE39260 ([gene|8D98212930CF6613D332BF99452B231CB6426E93|bglH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE39260 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTGATCACCCCATTAG,  downstream forward: _UP4_TGACAATTTTTTGAAAACTC
BKK39260 ([gene|8D98212930CF6613D332BF99452B231CB6426E93|bglH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK39260 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTGATCACCCCATTAG,  downstream forward: _UP4_TGACAATTTTTTGAAAACTC
References
14652714,16672620,15139916,7883710,7559347,26772920,23580646

8D98212930CF6613D332BF99452B231CB6426E93

Page visits: 3791

Time of last update: 2024-07-14 22:52:09

Author of last update: Melvin.boenninger