


Molecular weight
54.72 kDa
Protein length
Gene length
utilization of sucrose
sacA, ipa-50d

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1621 (Galperin et al., 2021)

This gene is a member of the following regulons

3,902,210 → 3,903,649
Visit Visit
The protein
Catalyzed reaction/ biological activity
Hydrolysis of terminal non-reducing beta-D-fructofuranoside residues in beta-D-fructofuranosides (according to UniProt)
Protein family
glycosyl hydrolase 32 family (with [protein|33BEC05F2129EBAF6699E847B0909A5A48F0E869|levB] and [protein|61D5B957E018D019AE0CE1D5F6C6A33EF982ED49|sacC], according to UniProt)
[PDB|3PIG] (beta-fructofuranosidase from Bifidobacterium longum, 29% identity) [pubmed|21418142]
Expression and Regulation
induced by sucrose ([protein|search|SacT]) [Pubmed|2163394]
regulatory mechanism
[protein|6796E1C147AA21E919A42A953884DC24E182F430|sacT]: antitermination, via binding to a [wiki|RNA switch], in [regulon|protein:6796E1C147AA21E919A42A953884DC24E182F430|sacT regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8702561], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2024-07-13 08:53:16





Biological materials
1A810 ( ''sacA''::''cat''), [Pubmed|15109830], available at [ BGSC]
1A811 ( ''sacA''::''kan''), [Pubmed|15109830], available at [ BGSC]
BKE38040 (Δ[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGTCATTTTTTCCTCTCCTC,  downstream forward: _UP4_TAGAAAATCCTTCTATTTTC
BKK38040 (Δ[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGTCATTTTTTCCTCTCCTC,  downstream forward: _UP4_TAGAAAATCCTTCTATTTTC


Page visits: 6789

Time of last update: 2024-07-15 05:10:50

Author of last update: Melvin.boenninger