panC

panC
168

[metabolite|pantothenate] synthase

locus
BSU_22420
Molecular weight
31.81 kDa
pI
4.63
Protein length
Gene length
function
biosynthesis of [metabolite|coenzyme A]
product
[metabolite|pantothenate] synthase
essential
quasi
ec
6.3.2.1
synonyms
panC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0414 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,352,977  2,353,837
Phenotypes of a mutant
the mutant tends to acquire suppressor mutations that result in improved growth [Pubmed|28189581]
quasi-essential, the mutant is auxotrophic for [metabolite|pantothenate] [https://www.biorxiv.org/content/10.1101/2024.04.17.589903v1.full.pdf bioRxiv]
the mutant is viable if it acquires mutations ([gene|50930C56C27D22715620A350220E3C56ADB41020|cymR] or [gene|D1FC976597E5583E40A4ED7234FBCA743AB01354|cysK]) that allow constitutive expression of [gene|A6A13C54177381CE78ABA2CFC2A3F2CE12099F15|tcyJ]-[gene|A8FA40EACDB15CF53DDDA725A3AA5A6EB654FA8B|tcyK]-[gene|350C97E4A4C60A6E2FF9610D50B4A49FB9F9B42D|tcyL]-[gene|B1DD32A3B3D1C0C5391A40834940257357A2F30F|tcyM]-[gene|B24763A732111026D21C828FF9BE73FB22A123CF|tcyN] for the uptake of [metabolite|cysteinopantetheine] [https://www.biorxiv.org/content/10.1101/2024.04.17.589903v1.full.pdf bioRxiv]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
(R)-[metabolite|pantoate] + [metabolite|ATP] + [metabolite|beta-alanine] --> (R)-[metabolite|pantothenate] + [metabolite|AMP] + [metabolite|diphosphate] + H+ (according to UniProt)
Protein family
[metabolite|pantothenate] synthetase family (single member, according to UniProt)
Structure
[PDB|2EJC] (from ''Thermotoga maritima'', 50% identity, 66% similarity)
[AF|P52998]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|A0001681244113B808757281C1B70C0C94F28A27|panB]-[gene|8BE55434677F4EC3D6766C7163496CB1B659F57F|panC]-[gene|EE712C1EC9E9C371847C83F7D75C189B276CD4B6|panD]-[gene|03BFD8AD2E3D95858752F46366F6C2028D709029|dinG]-[gene|08F907C6F47BDEB4DC9A9F136CDC6A4063AC0140|ypmA]-[gene|D3629004F3B54D11566AE15227174F9EB7784201|tseB]-[gene|AE802E1D4F827DED3A5D953C7D034E6A3554C45F|aspB]
description
[Pubmed|22383849]
Open in new tab

[gene|A0001681244113B808757281C1B70C0C94F28A27|panB]→[gene|AE802E1D4F827DED3A5D953C7D034E6A3554C45F|aspB]

2024-06-20 11:07:37

Jstuelk

51

3C14CF916926052D4B293230C8985ACC791FC72B

3C14CF916926052D4B293230C8985ACC791FC72B

Biological materials
Mutant
BKE22420 ([gene|8BE55434677F4EC3D6766C7163496CB1B659F57F|panC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE22420 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGAAATATCAGTAATCTGTC,  downstream forward: _UP4_ATTCGAGAAATGGAGAGAAT
BKK22420 ([gene|8BE55434677F4EC3D6766C7163496CB1B659F57F|panC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK22420 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGAAATATCAGTAATCTGTC,  downstream forward: _UP4_ATTCGAGAAATGGAGAGAAT
GP3379 ([gene|8BE55434677F4EC3D6766C7163496CB1B659F57F|panC]::neo trpC2), available in [wiki|Jörg Stülke]'s lab, use GP4402
GP4361 (trpC2 Δ[gene|8BE55434677F4EC3D6766C7163496CB1B659F57F|panC]::cat), available in [wiki|Jörg Stülke]'s lab
Expression vectors
pGP3723: expression of ''panC'' (''gapA'' RBS) by [wiki|pBQ200] in ''B. subtilis'', available in [wiki|Jörg Stülke]'s lab
References
35153321

8BE55434677F4EC3D6766C7163496CB1B659F57F

Page visits: 2624

Time of last update: 2024-06-17 06:07:41

Author of last update: Robert.warneke