ylnF

ylnF
168

probably precorrin-2 dehydrogenase

locus
BSU_15630
Molecular weight
17.86 kDa
pI
9.24
Protein length
Gene length
function
siroheme biosynthesis , sulfite reduction
product
probably precorrin-2 dehydrogenase
essential
no
synonyms
ylnF, sirC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1648 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,635,603  1,636,091
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
NAD+ + precorrin-2 --> 2 H+ + NADH + sirohydrochlorin (according to UniProt)
Protein family
ferrochelatase family (with [protein|E4C588EC93132CCBE4F40559F8A480A66A2D82D7|hemH], according to UniProt)
Structure
[PDB|3DFZ] (36% identity) [pubmed|18588505]
[AF|O34813]
Expression and Regulation
Operons
genes
[gene|51EB09C122A7166D662AE72842A44EC5FBA03134|cysH]-[gene|58A5A7F12664EC38AC21E24C1AD89671D7E648CF|cysP]-[gene|6CF2A9A517B641C44C0B46EF242BC5E668EA846B|sat]-[gene|3C71659E4868744A9301C26608EABF7B98217DCF|cysC]-[gene|92831D5A8E07A18BA6C6978123769D00D685BB45|ylnD]-[gene|9349C4646A56F933041EBE750F1BE86BAE7A60D9|sirB]-[gene|8BAB9B12D9D58A45446DC6CB7F48869089800FD3|ylnF]
description
[Pubmed|11004190]
regulation
induced by methionine starvation ([wiki|S-box]) [Pubmed|10094622]
the [wiki|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
[protein|50930C56C27D22715620A350220E3C56ADB41020|cymR]: transcription repression, [pubmed|], in [regulon|protein:50930C56C27D22715620A350220E3C56ADB41020|cymR regulon]
S-box: RNA switch, , the [wiki|S-box] [wiki|riboswitch] binds S-adenosylmethionine resulting in termination [Pubmed|10094622], in [regulon|other_regulator:S-box|S-box]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|11004190], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|51EB09C122A7166D662AE72842A44EC5FBA03134|cysH]→[gene|8BAB9B12D9D58A45446DC6CB7F48869089800FD3|ylnF]

2024-06-15 13:50:06

Jstuelk

68

ee26ed9bec04d4ffdc2deea174a197c7290dfe30

AC610BA23AE4EE98F22EC54E46509E3060BAE285

Biological materials
Mutant
MGNA-B370 (ylnF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1369 NBRP B. subtilis, Japan]
BKE15630 ([gene|8BAB9B12D9D58A45446DC6CB7F48869089800FD3|ylnF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE15630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATCACAACCTTCTTCTTTT,  downstream forward: _UP4_TAAGCCAGAGCATACAAATG
BKK15630 ([gene|8BAB9B12D9D58A45446DC6CB7F48869089800FD3|ylnF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK15630 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATCACAACCTTCTTCTTTT,  downstream forward: _UP4_TAAGCCAGAGCATACAAATG
References
10217486,16267287,11004190,12107147,18039762,18588505

8BAB9B12D9D58A45446DC6CB7F48869089800FD3

Page visits: 3207

Time of last update: 2024-06-22 01:16:48

Author of last update: Melvin.boenninger