hisB

hisB
168

imidazoleglycerol-phosphate dehydratase

locus
BSU_34900
Molecular weight
21.40 kDa
pI
5.6
Protein length
Gene length
function
biosynthesis of histidine
product
imidazoleglycerol-phosphate dehydratase
essential
no
ec
4.2.1.19
synonyms
hisB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0131 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,585,690 3,586,274
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
D-erythro-1-(imidazol-4-yl)glycerol 3-phosphate --> 3-(imidazol-4-yl)-2-oxopropyl phosphate + H2O (according to UniProt)
Protein family
imidazoleglycerol-phosphate dehydratase family (single member, according to UniProt)
Structure
[PDB|2AE8] (from ''Staphylococcus aureus subsp. aureus n315 mutant'', 48% identity, 65% similarity)
[AF|O34683]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|E8FD92F48BE16F87D7481262F4E49003A78DE78F|hisZ]-[gene|183C8B4F28E601D670B3D997D333AF2B5C4A4759|hisG]-[gene|03274B80B2DFE0A2939981B0E0CB8C34A9B0B102|hisD]-[gene|88ED20DFEBD5D7B985F99D4494142FBA699A1E91|hisB]-[gene|DEB3122A3EA36545759FAA6F86F71F971CA5F011|hisH]-[gene|148F0C7983250F50676D234DB713E532AA55DDBF|hisA]-[gene|C22C15754859B2510E52622E6A5DFAF97A7AD4E5|hisF]-[gene|5C84CA2A9E22173E144F519389F545F107A267D9|hisI]
description
[Pubmed|12107147]
regulation
expression during spore [wiki|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
expression depends on functional [protein|F4097349A563503468A2A14F062AEAC532C7917A|rnpM] [pubmed|30355672]
regulatory mechanism
[protein|F4097349A563503468A2A14F062AEAC532C7917A|rnpM]: unknown, [pubmed|30355672], in [regulon|protein:F4097349A563503468A2A14F062AEAC532C7917A|rnpM regulon]
Open in new tab

[gene|E8FD92F48BE16F87D7481262F4E49003A78DE78F|hisZ]→[gene|5C84CA2A9E22173E144F519389F545F107A267D9|hisI]

2024-05-21 21:14:32

Jstuelk

88

896e17f5309df81d9427f38fec175515ad428723

B6AAF7601668444EDDC2FE084A87885740B98ACD

Biological materials
Mutant
BKE34900 ([gene|88ED20DFEBD5D7B985F99D4494142FBA699A1E91|hisB]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE34900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCCTGACGCGTTCCGCTT, downstream forward: _UP4_CCGTCAACGAAAGGGATGCT
BKK34900 ([gene|88ED20DFEBD5D7B985F99D4494142FBA699A1E91|hisB]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK34900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCCTGACGCGTTCCGCTT, downstream forward: _UP4_CCGTCAACGAAAGGGATGCT
References
12107147,15378759,27766092

88ED20DFEBD5D7B985F99D4494142FBA699A1E91

Page visits: 3062

Time of last update: 2024-05-21 14:23:29

Author of last update: Melvin.boenninger