

RNase Y, 5 end sensitive endoribonuclease, involved in the degradation/ processing of mRNA, part of the putative [wiki|RNA degradosome]

Molecular weight
58.75 kDa
Protein length
Gene length
RNA processing and degradation
RNase Y
rny, ymdA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1418 (Galperin et al., 2021)

This gene is a member of the following regulons

1,767,310  1,768,872
Phenotypes of a mutant
quasi-essential [pubmed|34157109]
transcription profile resulting from [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|rny] depletion: [http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE30430 GEO] [Pubmed|21815947]
loss of [wiki|genetic competence] [pubmed|33897624]
defect in spore [wiki|germination] [Pubmed|22209493]
the mutant is strongly impaired in [wiki|sporulation], [wiki|genetic competence] and many other traits [Pubmed|23504012]
it is not possible to construct a [gene|3EB289D0F58A58C693AB588798EE66A731341999|rnjA] [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|rny] double mutant  [Pubmed|23504012]
the inactivation of the [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|rny] gene leads to the rapid accumulation of suppressor mutations that result in strongly reduced transcription [pubmed|34157109]
knockdown of expression results in loss of [category|SW.5.2.1|ICEBs1] conjugation (both in donor cells) [pubmed|35490406]
the [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|rny] mRNA binds to [category|SW.|RNA polymerase] [pubmed|38348908]
Visit Sartorius.com Visit Sartorius.com
The protein
Catalyzed reaction/ biological activity
processing, maturation and degradation of mRNAs, see [wiki|RNase Y targets]
[wiki|RNase] Y cleaves [protein|search|S-box] [gene|C245476CE35028167510F67153F392D91447553F|mgtE riboswitch] RNAs ''in vivo'' and ''in vitro'' [Pubmed|19779461]
preference for 5' monophosphorylated substrate ''in vitro'' [Pubmed|19779461]
endonucleolytic cleavage [Pubmed|19779461]
required for the processing of the [gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA] operon mRNA [Pubmed|19193632]
cleavage activity appears sensitive to downstream secondary structure [Pubmed|19779461]
[wiki|RNase] Y initiates the degradation of [gene|EC5D3ECF361C7CDEB606284F5E17243CD926989E|rpsO] mRNA [Pubmed|20418391]
[wiki|RNase] Y is responsible for the degradation of [wiki|23S rRNA], [wiki|16S rRNA], and mRNAs in aging spores [Pubmed|22209493]
[wiki|RNase] Y cleaves the leader of the [gene|4F9D70C4BB4FCA809BEAC341C3F8122FB7FD8872|cwlO] mRNA at a stem-loop structure [Pubmed|24163346]
3' end maturation of [gene|57A79AAF00243B5E058FA901D43AA7B55CA33F63|RNase P RNA] and [gene|097C817A5A3E31F73F6ABC4AA95852A64E43A057|scRNA] [Pubmed|25402410]
Protein family
RNase Y family (single member, according to UniProt)
transmembrane domain\t(aa 524) [Pubmed|21803996]
coiled-coiled domain (may form a leucine zipper) (aa 30-150) [Pubmed|21803996]
[wiki|KH domain]\t(aa 210-280) [Pubmed|21803996,18422648]
[wiki|HD domain] (aa 330-430) [Pubmed|21803996,9868367]
C-terminal domain (aa 430-520)  [Pubmed|21803996]
requires Mg2+, which can be replaced by Zn2+ or Mn2+ ions, [Pubmed|19779461]
[PDB|6F7T] (the N-teminal part, aa 1 ... 218) [pubmed|30447990]
Effectors of protein activity
appears sensitive to downstream secondary structure [Pubmed|19779461]
interaction of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] with the complex of [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|ricA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|ricF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|ricT] stimulates the degradation and maturation of several polycistronic mRNAs [Pubmed|29794222,26434553]
interaction of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] with the complex of [protein|67651D5D3122A89F57F9E7D49074C82A8990A277|eno] and [protein|19080097FD3F48C730C355DE84C1922206A07AFF|SR7P] stimulates the degradation and maturation of several target RNAs [pubmed|32752915]
cell membrane,  single-pass membrane protein  [Pubmed|18763711,17005971,19820159,27708634,32071272,34417617]
forms foci at the site of septation [Pubmed|23060960]
Additional information
required for the processing of the [gene|EB6512177418B1601C6641FB2DEE99C2CD10E671|gapA] operon mRNA
Expression and Regulation
additional information
the [wiki|transcription] terminator between ''[wiki|rny]'' and ''[wiki|ymdB]'' is strong and [wiki|NusA]-independent [http://www.nature.com/articles/nmicrobiol20157 Reference]
Open in new tab


2024-06-09 18:58:26





additional information
the [wiki|transcription] terminator between ''[wiki|rny]'' and ''[wiki|ymdB]'' is strong and [wiki|NusA]-independent [http://www.nature.com/articles/nmicrobiol20157 Reference]
Open in new tab


2024-05-29 21:28:28





Biological materials
4043 (''rny'' under p-spac control, ''cat''), GP193 (''rny'' under p-xyl control, ''cat''), both available in [wiki|Jörg Stülke]'s lab
GP2501 (Δ[gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|rny]::spc) available in [wiki|Jörg Stülke]'s lab [pubmed|33897624]
GP2524 ([gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|rny]::''ermC''), available in [wiki|Jörg Stülke]'s lab
BKE16960 ([gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|rny]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE16960 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACTTTCACCTCCTCTTG,  downstream forward: _UP4_TAAAGTGATGCGCTAAGCAT
BKK16960 ([gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|rny]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK16960 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACTTTCACCTCCTCTTG,  downstream forward: _UP4_TAAAGTGATGCGCTAAGCAT
Expression vectors
N-terminal Strep-tag, expression in ''E. coli'', in [wiki|pGP172]: pGP441, available in [wiki|Jörg Stülke]'s lab
pGP2813: IPTG inducible expression, purification in ''E. coli'' with N-terminal Strep-tag, in [wiki|pGP172], available in [wiki|Jörg Stülke]'s lab
N-terminal Strep-tag, for [wiki|SPINE], expression in ''B. subtilis'', in [wiki|pGP380]: pGP775, available in [wiki|Jörg Stülke]'s lab
C-terminal Strep-tag, for [wiki|SPINE], expression in ''B. subtilis'', in [wiki|pGP382]: pGP1852, available in [wiki|Jörg Stülke]'s lab
Expression of RNase Y missing the N-terminal transmembrane domain (25aa) as an intein fusion in E. coli (no tag left in the purified protein) available in the [wiki|Putzer] lab
wild type ''rny'', expression in ''B. subtilis'', in [wiki|pBQ200]: pGP1201, available in [wiki|Jörg Stülke]'s lab
there is also a series of domain constructs present in [wiki|pBQ200], all available in [wiki|Jörg Stülke]'s lab
chromosomal expression of Rny-Strep, ''spc'': GP1033, available in [wiki|Jörg Stülke]'s lab
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab, [pubmed|19193632]
FLAG-tag construct
GP1030 (spc, based on [wiki|pGP1331]), available in [wiki|Jörg Stülke]'s lab
lacZ fusion
pGP459 (in [wiki|pAC7]), available in [wiki|Jörg Stülke]'s lab
available in [wiki|van Dijl] and in [wiki|Jörg Stülke]'s lab
GFP fusion
B. subtilis 3569 (amyE:: (p-xyl rny-gfpmut1-spc)), available in [wiki|Errington] lab
pGP1368 for chromosomal expression of rny-YFP, available in [wiki|Jörg Stülke]'s lab
[wiki|Ciaran Condon], IBPC Paris, France [http://www.ibpc.fr/UPR9073/equipe_Ciaran/AccueilCCondonGB.htm Homepage]
[wiki|Harald Putzer], IBPC Paris, France [http://www.ibpc.fr/UPR9073/putzer/recherches_harald.htm Homepage]
[wiki|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]
Original Publications
Publications on homologs from other organisms


Page visits: 9865

Time of last update: 2024-06-22 08:17:30

Author of last update: Jstuelk