ilvK

ilvK
168

branched-chain amino acid aminotransferase

locus
BSU_38550
Molecular weight
40.16 kDa
pI
4.95
Protein length
Gene length
function
biosynthesis of branched-chain amino acids
product
branched-chain amino acid aminotransferase
essential
no
ec
2.6.1.42
synonyms
ywaA, ipa-0r

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0115 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,957,391 3,958,482
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
2-oxoglutarate + L-leucine --> 4-methyl-2-oxopentanoate + L-glutamate (according to UniProt)
2-oxoglutarate + L-isoleucine --> (S)-3-methyl-2-oxopentanoate + L-glutamate (according to UniProt)
2-oxoglutarate + L-valine --> 3-methyl-2-oxobutanoate + L-glutamate (according to UniProt)
Protein family
[wiki|Class-IV pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
[wiki|Cofactors]
PLP
Structure
[PDB|3HT5] (from '' Mycobacterium tuberculosis'', 42% identity, 58% similarity) [Pubmed|19923721]
[AF|P39576]
Modification
S-cysteinylation after diamide stress (C104) [Pubmed|17611193]
Paralogous protein(s)
[protein|2A20EF701B9F78FC21A33D6BD8ED862323BA59A8|ilvE]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|8163996FCB9D02F771E7A04A91D5720027260F12|ilvK]
description
[Pubmed|9353933]
regulation
repressed during growth in the presence of branched chain amino acids ([protein|search|CodY]) [Pubmed|24163341]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|24163341], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
Open in new tab

[gene|8163996FCB9D02F771E7A04A91D5720027260F12|ilvK]

2024-05-22 03:24:07

ghost

76

651105c8ef41c65a8034fda4ffb818741e12316f

AEEBD14281489BB37128A0CEDE8C71348D61CE7B

Biological materials
Mutant
MGNA-B757 (ywaA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1756 NBRP B. subtilis, Japan]
a ''ywaA::spc'' mutant and a ''[gene|A52E50104B18D0A8518218C52D9CC36FDDB29AAF|bcd] [gene|2A20EF701B9F78FC21A33D6BD8ED862323BA59A8|ilvE] [gene|8163996FCB9D02F771E7A04A91D5720027260F12|ilvK]'' triple mutant are available in [wiki|Linc Sonenshein]'s lab
BKE38550 ([gene|8163996FCB9D02F771E7A04A91D5720027260F12|ilvK]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE38550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTCAATCTCCCTGCTG, downstream forward: _UP4_TAAGAAAAAAGCCGGCCCAT
BKK38550 ([gene|8163996FCB9D02F771E7A04A91D5720027260F12|ilvK]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK38550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTCAATCTCCCTGCTG, downstream forward: _UP4_TAAGAAAAAAGCCGGCCCAT
References
12670965,17611193,24163341,15378759,28516784

8163996FCB9D02F771E7A04A91D5720027260F12

Page visits: 4912

Time of last update: 2024-05-23 04:34:30

Author of last update: Robert.warneke