ribT

ribT
168

GCN5-like acetyltransferase (GNAT), acetylates [protein|2A5DCBFAB51996F0DDEC964D5D178274AF86CE69|ribH] on K29

locus
BSU_23240
Molecular weight
14.43 kDa
pI
5.75
Protein length
Gene length
function
acetylation of [protein|2A5DCBFAB51996F0DDEC964D5D178274AF86CE69|ribH]
product
[protein|2A5DCBFAB51996F0DDEC964D5D178274AF86CE69|ribH] acetyltransferase
essential
no
synonyms
ribT, ribD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0456 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,427,405  2,427,779
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
acetylates [protein|2A5DCBFAB51996F0DDEC964D5D178274AF86CE69|ribH] on K29 [pubmed|35495702]
[wiki|Domains]
[wiki|N-acetyltransferase domain] (aa 3-124) (according to UniProt)
Structure
[PDB|5XXS] [pubmed|29241954]
[AF|P17622]
[wiki|Localization]
cytoplasm [pubmed|35495702]
Expression and Regulation
Operons
genes
[gene|3DFCF7C5FE15C9A3E9E7E4B0DA8E926B85DBD180|ribD]-[gene|4E18BD4B084094EE4FBC8FE2AC95B14581D20C0F|ribE]-[gene|F07B7062C850106A95C15978E36DA500F8B089D6|ribA]-[gene|2A5DCBFAB51996F0DDEC964D5D178274AF86CE69|ribH]-[gene|8146A052E4E7844F781E7169C264EC927DEB7387|ribT]
description
[Pubmed|8159171]
regulation
expressed in the absence of FMN ([wiki|FMN-box]) [Pubmed|15808508]
binding of [protein|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR] to the [wiki|FMN-box] riboswitch can enforce expression even in the presence of FMN [pubmed|26494285]
the [wiki|FMN-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
regulatory mechanism
FMN-box: RNA switch, via [wiki|FMN-box] in the presence of FMN or FMNH2, this is counter-acted upon binding of [protein|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR], in [regulon|other_regulator:FMN-box|FMN-box]
[protein|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR]: antitermination, [pubmed|26494285], in [regulon|protein:3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8159171], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|3DFCF7C5FE15C9A3E9E7E4B0DA8E926B85DBD180|ribD]→[gene|8146A052E4E7844F781E7169C264EC927DEB7387|ribT]

2024-06-08 12:44:39

Jstuelk

99

3D660447137821317811200D29A5FC04A41E938E

05C8A4E892E7DB3D953FE72E8765638644759326

Biological materials
Mutant
BKE23240 ([gene|8146A052E4E7844F781E7169C264EC927DEB7387|ribT]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE23240 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAAACCCCTCTATATC,  downstream forward: _UP4_TAAGCAGAGGCTGTGATCAG
BKK23240 ([gene|8146A052E4E7844F781E7169C264EC927DEB7387|ribT]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK23240 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAAACCCCTCTATATC,  downstream forward: _UP4_TAAGCAGAGGCTGTGATCAG
References
12456892,15808508,23270261,8159171,7934830,24442413,25349719,26494285,29241954,29805114,35495702

8146A052E4E7844F781E7169C264EC927DEB7387

Page visits: 4108

Time of last update: 2024-06-23 13:46:57

Author of last update: Jstuelk