fbaA

fbaA
168

[metabolite|fructose-1,6-bisphosphate] aldolase, glycolytic/ gluconeogenic enzyme

locus
BSU_37120
Molecular weight
30.25 kDa
pI
5.03
Protein length
Gene length
function
enzyme in glycolysis/ gluconeogenesis
product
[metabolite|fructose-1,6-bisphosphate] aldolase
essential
no
ec
4.1.2.13
synonyms
fbaA, fba, fba1, tsr

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0191 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,808,512 3,809,369
Phenotypes of a mutant
essential [Pubmed|12682299], non-essential according to [Pubmed|23420519]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
D-[metabolite|fructose-1,6-bisphosphate] --> D-[metabolite|glyceraldehyde-3-P] + [metabolite|dihydroxyacetone-P] (according to UniProt)
Protein family
class II fructose-bisphosphate aldolase family (with [protein|1EFB5C8F28146D1EA3B615F548D0CF262D2B4DF5|iolJ], according to UniProt)
[wiki|Domains]
2 x [metabolite|dihydroxyacetone-P] binding domain (210212), (231234)
[wiki|Cofactors]
Zn2+ (Metalloenzyme)
Structure
[PDB|3Q94] (from ''Bacillus anthracis'')
[AF|P13243]
Modification
phosphorylation on Thr-212 and Thr-234 [Pubmed|17218307]
Effectors of protein activity
Inhibited by [metabolite|2-oxoglutarate], [metabolite|oxaloacetate] and [metabolite|pyruvate] [Pubmed|24624] [Pubmed|15125960]
Activated by NH4+ [Pubmed|15125960]
Paralogous protein(s)
[protein|1EFB5C8F28146D1EA3B615F548D0CF262D2B4DF5|iolJ]
Additional information
Binds 2 zinc ions per subunit. One is catalytic and the other provides a structural contribution
extensive information on the structure and enzymatic properties of FbaA can be found at [http://www.proteopedia.org/wiki/index.php/Fructose_Bisphosphate_Aldolase Proteopedia]
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|800EC1F1CA8C4F2A643EDECBB684347C29CAB0CA|fbaA]
description
[Pubmed|11489127]
regulation
constitutively expressed [Pubmed|11489127]
Open in new tab

[gene|800EC1F1CA8C4F2A643EDECBB684347C29CAB0CA|fbaA]

2024-07-13 18:55:46

ghost

61

b23bd4d20860aa2cbd12c1df4a5b0dbe0987693a

794BD730BB0613B1D4766C3206D0909D47CD7322

genes
[gene|800EC1F1CA8C4F2A643EDECBB684347C29CAB0CA|fbaA]-[gene|1419F2F99D924973D75EE6FAA41F9A27EC5283E1|ywjH]
description
[Pubmed|11489127]
regulation
constitutively expressed [Pubmed|11489127]
Open in new tab

[gene|800EC1F1CA8C4F2A643EDECBB684347C29CAB0CA|fbaA]→[gene|1419F2F99D924973D75EE6FAA41F9A27EC5283E1|ywjH]

2024-07-12 02:28:13

ghost

85

3de4c158d0f59e42a135e3344384ecf580467739

F733D4A7CF3474C9704F8FE6039F28B670F0B03B

Biological materials
Mutant
GP591 (''fbaA''::''cat''), available in [wiki|Jrg Stlke]'s lab, [Pubmed|23420519]
GP596 (''fbaA''::''erm''), available in [wiki|Jrg Stlke]'s lab, [Pubmed|23420519]
BKE37120 ([gene|800EC1F1CA8C4F2A643EDECBB684347C29CAB0CA|fbaA]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE37120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCGAATGTCCTCCTTA, downstream forward: _UP4_TAATTCAATTGGAACTTTTT
BKK37120 ([gene|800EC1F1CA8C4F2A643EDECBB684347C29CAB0CA|fbaA]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK37120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCGAATGTCCTCCTTA, downstream forward: _UP4_TAATTCAATTGGAACTTTTT
Expression vectors
for expression in ''B. subtilis'', in [wiki|pBQ200]: pGP1423, available in [wiki|Jrg Stlke]'s lab
for expression/ purification from ''B. subtilis'' with N-terminal Strep-tag, for [wiki|SPINE], in [wiki|pGP380]: pGP88, available in [wiki|Jrg Stlke]'s lab, [pubmed|19193632]
for expression/ purification from ''E. coli'' with N-terminal His-tag, in [wiki|pWH844]: pGP395, available in [wiki|Jrg Stlke]'s lab
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jrg Stlke]'s lab [pubmed|19193632]
lacZ fusion
pGP601 (in [wiki|pAC6]), available in [wiki|Jrg Stlke]'s lab [pubmed|11489127]
References
Reviews
25267444
Original Publications
36815589,17218307,15125960,24624,16843441,11489127,20525796,23420519,23033921,24571712,15378759

800EC1F1CA8C4F2A643EDECBB684347C29CAB0CA

Page visits: 6670

Time of last update: 2024-07-15 05:01:30

Author of last update: Jstuelk