rpmI

rpmI
168

ribosomal protein bL35

locus
BSU_28860
Molecular weight
7.42 kDa
pI
12.52
Protein length
Gene length
function
translation
product
ribosomal protein L35 (bL35)
essential
no
synonyms
rpmI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0291 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,952,615  2,952,815
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Protein family
bacterial [wiki|ribosomal protein] bL35 family (single member, according to UniProt)
Structure
[PDB|3J9W] (the [wiki|ribosome]) [Pubmed|25903689]
[AF|P55874]
Additional information
the protein is significantly underrepresented in 45S assembly intermediates that accumulate upon depletion of [protein|54CD247926F7FABE4ACE85EB7021B62500B47260|rbgA] [Pubmed|24335279,23700310]
this ribosomal protein is lacking in some organisms with very small genomes [pubmed|33753464]
Expression and Regulation
Operons
genes
[gene|E27012060B8220E55277A23C20B1BA6DDBBA4AD1|infC]-[gene|7F22743ED669DBCD4089EA2F86B8FFD924F8C2B9|rpmI]-[gene|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|rplT]-[gene|19349FDFE0F9A46FCCAA684B8139E592979DB317|ysdA]
description
[Pubmed|17289755]
regulation
[protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|rel] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
regulatory mechanism
stringent response: negative regulation, in [regulon|other_regulator:stringent response|stringent response]
[protein|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|rplT]: termination, via binding to a [wiki|RNA switch] in the [gene|E27012060B8220E55277A23C20B1BA6DDBBA4AD1|infC] leader region causes transcription termination, in [regulon|protein:803313600B3CEEE742BD6E5D650B94FB2D32B9EF|rplT regulon]
additional information
autorepression of [gene|E27012060B8220E55277A23C20B1BA6DDBBA4AD1|infC]-[gene|7F22743ED669DBCD4089EA2F86B8FFD924F8C2B9|rpmI]-[gene|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|rplT]-[gene|19349FDFE0F9A46FCCAA684B8139E592979DB317|ysdA] expression upon binding of excess [protein|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|rplT] to the untranslated region of the mRNA [Pubmed|29925569,17616982]
expression of [protein|E27012060B8220E55277A23C20B1BA6DDBBA4AD1|IF3 ]is uncoupled from that of [protein|7F22743ED669DBCD4089EA2F86B8FFD924F8C2B9|L35 ]and [protein|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|L20 ]by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y]-dependent mRNA processing [PubMed|21843271]
the [wiki|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
Open in new tab

[gene|E27012060B8220E55277A23C20B1BA6DDBBA4AD1|infC]→[gene|19349FDFE0F9A46FCCAA684B8139E592979DB317|ysdA]

2024-07-08 14:59:05

Jstuelk

97

6ec080dce630885303f3f439404a1624accce660

33D5901765B267FCB4C316CA6BBC47536C5ACFC6

Biological materials
Mutant
BKE28860 ([gene|7F22743ED669DBCD4089EA2F86B8FFD924F8C2B9|rpmI]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE28860 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGGATTTCCTCCTTATT,  downstream forward: _UP4_TAATCGGATAAGGAACAATT
BKK28860 ([gene|7F22743ED669DBCD4089EA2F86B8FFD924F8C2B9|rpmI]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK28860 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGGGATTTCCTCCTTATT,  downstream forward: _UP4_TAATCGGATAAGGAACAATT
References
19653700,17289755,11948165,21843271,23002217,24335279,23700310,25903689,29925569,33753464

7F22743ED669DBCD4089EA2F86B8FFD924F8C2B9

Page visits: 3858

Time of last update: 2024-07-15 04:04:09

Author of last update: Jstuelk