

[metabolite|carbamoyl-P] transferase ([metabolite|arginine]) (subunit B)

Molecular weight
112.75 kDa
Protein length
Gene length
biosynthesis of [metabolite|arginine]
[metabolite|carbamoyl-P] transferase ([metabolite|arginine]) (subunit B)

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0458 (Galperin et al., 2021)

This gene is a member of the following regulons

1,200,381 1,203,473
Visit Visit
The protein
Catalyzed reaction/ biological activity
2 [metabolite|ATP] + H2O + [metabolite|bicarbonate] + L-[metabolite|glutamine] --> 2 [metabolite|ADP] + [metabolite|carbamoyl-P] + 2 H+ + L-[metabolite|glutamate] + [metabolite|phosphate] (according to UniProt)
Protein family
carB family (with [protein|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB], according to UniProt)
2 [wiki|ATP-grasp doamin]s (aa 133-327, aa 675-863) (according to UniProt)
MGS-like domain (aa 925-1027) (according to UniProt)
[PDB|1JDB] (from ''Escherichia coli'', 47% identity, 64% similarity) [Pubmed|10089390]
Paralogous protein(s)
Additional information
subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
repressed by arginine ([protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]) [Pubmed|1312212]
induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|rnpM] [pubmed|30355672]
regulatory mechanism
[protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC]: repression, [Pubmed|1312212], in [regulon|protein:62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|ahrC regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|24843172], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|F4097349A563503468A2A14F062AEAC532C7917A|rnpM]: unknown, [pubmed|30355672], in [regulon|protein:F4097349A563503468A2A14F062AEAC532C7917A|rnpM regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|7511775], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2024-05-21 19:14:54





Biological materials
BKE11240 ([gene|7E6386F1949A6F46E4332BAB8F803742EB076AF0|carB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAATATGCTTGAAATACTGG, downstream forward: _UP4_CTCTATAAAAAGGAAGTGGC
BKK11240 ([gene|7E6386F1949A6F46E4332BAB8F803742EB076AF0|carB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAATATGCTTGAAATACTGG, downstream forward: _UP4_CTCTATAAAAAGGAAGTGGC
GP3715 ([gene|7E6386F1949A6F46E4332BAB8F803742EB076AF0|carB]::aphA3 trpC2) available in the [wiki|Stülke] lab
Expression vectors
pGP3783: expression of Strep-''carB'' by [wiki|pGP380] in ''B. subtilis'' suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab


Page visits: 4292

Time of last update: 2024-05-23 12:57:15

Author of last update: Jstuelk