

ribosomal protein S1, contributes to mRNA delivery to the ribosome by RNA polymerase

Molecular weight
42.24 kDa
Protein length
Gene length
ribosomal protein S1
ypfD, jofD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0539 (Galperin et al., 2021)

This gene is a member of the following regulons

2,394,664 2,395,812
Visit Sartorius.com Visit Sartorius.com
The protein
Catalyzed reaction/ biological activity
contributes to mRNA delivery to the ribosome by RNA polymerase [https://www.biorxiv.org/content/10.1101/2024.03.19.585789v1.full.pdf bioRxiv]
Protein family
bacterial [wiki|ribosomal protein] bS1 family (single member, according to UniProt)
4 reiterated [wiki|S1 domain]s (aa 16-84, aa 102-167, aa 188-256, aa 273-342) (according to UniProt)
[PDB|6BU8] (E. coli protein, 39% identity) [pubmed|29247757]
[PDB|5X8R] (chloroplast, small ribosomal subunit, 37% identity to aa 14 .. 266) [pubmed|28582576]
[PDB|1SRO] (E. coli S1 RNA-binding domain, 37% identity to aa 185 ... 343) [pubmed|9008164]
phosphorylation on Ser-243 [Pubmed|17218307]
cytoplasm, region surrounding the nucleoid [pubmed|36406443]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Open in new tab


2024-05-30 04:53:11





Open in new tab


2024-06-16 16:20:21





Open in new tab


2024-06-20 22:32:32





Open in new tab


2024-06-18 07:22:25





Open in new tab


2024-06-20 11:21:31





Open in new tab


2024-06-01 04:43:57





additional information
expression is reduced in motile cells as compared to non-motile cells [pubmed|33782055]
Biological materials
BKE22880 ([gene|7C36409F155E4C91CEE902FE6937571BD0C50128|rpsA]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE22880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAATAACCTCCTTGG, downstream forward: _UP4_TAATTGGTGATAAACGTGAC
BKK22880 ([gene|7C36409F155E4C91CEE902FE6937571BD0C50128|rpsA]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK22880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAATAACCTCCTTGG, downstream forward: _UP4_TAATTGGTGATAAACGTGAC


Page visits: 4321

Time of last update: 2024-06-20 03:30:03

Author of last update: Jstuelk