rpsA

rpsA
168

ribosomal protein S1, contributes to mRNA delivery to the ribosome by RNA polymerase

locus
BSU_22880
Molecular weight
42.24 kDa
pI
4.57
Protein length
Gene length
function
translation
product
ribosomal protein S1
essential
no
synonyms
ypfD, jofD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0539 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,394,664 2,395,812
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
contributes to mRNA delivery to the ribosome by RNA polymerase [https://www.biorxiv.org/content/10.1101/2024.03.19.585789v1.full.pdf bioRxiv]
Protein family
bacterial [wiki|ribosomal protein] bS1 family (single member, according to UniProt)
[wiki|Domains]
4 reiterated [wiki|S1 domain]s (aa 16-84, aa 102-167, aa 188-256, aa 273-342) (according to UniProt)
Structure
[PDB|6BU8] (E. coli protein, 39% identity) [pubmed|29247757]
[PDB|5X8R] (chloroplast, small ribosomal subunit, 37% identity to aa 14 .. 266) [pubmed|28582576]
[PDB|1SRO] (E. coli S1 RNA-binding domain, 37% identity to aa 185 ... 343) [pubmed|9008164]
[AF|P38494]
Modification
phosphorylation on Ser-243 [Pubmed|17218307]
[wiki|Localization]
cytoplasm, region surrounding the nucleoid [pubmed|36406443]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|1ADB6E2C8DC82A242CFEFAD22443D14226F1BA60|cmk]-[gene|7C36409F155E4C91CEE902FE6937571BD0C50128|rpsA]
description
[pubmed|22383849]
Open in new tab

[gene|1ADB6E2C8DC82A242CFEFAD22443D14226F1BA60|cmk]→[gene|7C36409F155E4C91CEE902FE6937571BD0C50128|rpsA]

2024-07-01 13:43:09

Jstuelk

79

396729db8cdec0e56ce52b9d8176ea318566cef6

093D1176322900FD3618A42D41D2AEA1E3C4BE07

genes
[gene|1ADB6E2C8DC82A242CFEFAD22443D14226F1BA60|cmk]-[gene|7C36409F155E4C91CEE902FE6937571BD0C50128|rpsA]-[gene|E91624382EC3DAABFB3123CDA818B4BEF745ACE6|fni]
description
[pubmed|22383849]
Open in new tab

[gene|1ADB6E2C8DC82A242CFEFAD22443D14226F1BA60|cmk]→[gene|E91624382EC3DAABFB3123CDA818B4BEF745ACE6|fni]

2024-07-09 17:51:23

Jstuelk

93

b56967b84c1bb47ba8c616de4931b2c8bed64802

1B9CB16A7EDCD5BF30213E1E4311C8B2D2B02BB4

genes
[gene|7C36409F155E4C91CEE902FE6937571BD0C50128|rpsA]-[gene|E91624382EC3DAABFB3123CDA818B4BEF745ACE6|fni]
description
[pubmed|22383849]
Open in new tab

[gene|7C36409F155E4C91CEE902FE6937571BD0C50128|rpsA]→[gene|E91624382EC3DAABFB3123CDA818B4BEF745ACE6|fni]

2024-07-04 03:55:28

Jstuelk

88

59f3916fce3e48c8c6ff7f585f1bca41eb2e3c88

5FF221244B4F9D377716054C5E17F60067F95631

genes
[gene|7C36409F155E4C91CEE902FE6937571BD0C50128|rpsA]
description
[pubmed|22383849]
Open in new tab

[gene|7C36409F155E4C91CEE902FE6937571BD0C50128|rpsA]

2024-06-28 11:26:54

Jstuelk

74

aca397c6b7a56531b29df294cf7d50e805d19479

6D5AC5C5495595E7FA0F5AEF56978BD20D730F25

genes
[gene|C194336ED96FA844FFE9FB43BE59ADC5D6DDB3BE|motI]-[gene|3459BA0CDAABC288ADF97B111F78C7EAC184840D|ypfB]-[gene|1ADB6E2C8DC82A242CFEFAD22443D14226F1BA60|cmk]-[gene|7C36409F155E4C91CEE902FE6937571BD0C50128|rpsA]-[gene|E91624382EC3DAABFB3123CDA818B4BEF745ACE6|fni]
description
[pubmed|22383849]
Open in new tab

[gene|C194336ED96FA844FFE9FB43BE59ADC5D6DDB3BE|motI]→[gene|E91624382EC3DAABFB3123CDA818B4BEF745ACE6|fni]

2024-07-12 02:52:47

Jstuelk

106

40589d593f2ed9acd667e06cee390577206bc679

B16C0E2FDCD0AB8461F12841F5F6E879CEC5BE2C

genes
[gene|C194336ED96FA844FFE9FB43BE59ADC5D6DDB3BE|motI]-[gene|3459BA0CDAABC288ADF97B111F78C7EAC184840D|ypfB]-[gene|1ADB6E2C8DC82A242CFEFAD22443D14226F1BA60|cmk]-[gene|7C36409F155E4C91CEE902FE6937571BD0C50128|rpsA]
description
[pubmed|22383849]
Open in new tab

[gene|C194336ED96FA844FFE9FB43BE59ADC5D6DDB3BE|motI]→[gene|7C36409F155E4C91CEE902FE6937571BD0C50128|rpsA]

2024-07-05 22:29:44

Jstuelk

62

e8404d7a4ece2ad33ad4f2d223369df3e684ff6d

BB9E8E7CE0132FE9AD9D01FF7333E5A2FF968CEF

additional information
expression is reduced in motile cells as compared to non-motile cells [pubmed|33782055]
Biological materials
Mutant
BKE22880 ([gene|7C36409F155E4C91CEE902FE6937571BD0C50128|rpsA]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE22880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAATAACCTCCTTGG, downstream forward: _UP4_TAATTGGTGATAAACGTGAC
BKK22880 ([gene|7C36409F155E4C91CEE902FE6937571BD0C50128|rpsA]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK22880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAATAACCTCCTTGG, downstream forward: _UP4_TAATTGGTGATAAACGTGAC
References
36815589,17218307,20525796,23002217,15378759,28516784,28582576,9008164,7704259,33782055,29247757,36406443

7C36409F155E4C91CEE902FE6937571BD0C50128

Page visits: 4415

Time of last update: 2024-07-15 05:00:11

Author of last update: Jstuelk