yxbB

yxbB
168

similar to S-adenosyl-L-methionine-dependent methyltransferase

locus
BSU_39890
Molecular weight
28.07 kDa
pI
4.57
Protein length
Gene length
function
unknown
product
putative S-adenosyl-L-methionine-dependent methyltransferase
essential
no
synonyms
yxbB, yxaP

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2226 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
4,097,416  4,098,150
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Protein family
[wiki|Methyltransferase superfamily] (according to UniProt)
Structure
[PDB|3DLC] (from Methanococcus maripaludis, corresponds to aa 21 ... 193, 30% identity)
[AF|P46326]
Expression and Regulation
Operons
genes
[gene|787BB72119DB1321A8281D7C46FED28CAEDBC97C|yxbB]-[gene|88B01CC87394AEE693A98574F9343EBF99F0D60E|yxbA]-[gene|A15368CD02487EBC1AF999FED34672E38167BCB2|yxnB]
description
[Pubmed|20185509]
regulation
repressed by glucose (8-fold) [Pubmed|12850135]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|12618455], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|15101989], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|20185509], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|787BB72119DB1321A8281D7C46FED28CAEDBC97C|yxbB]→[gene|A15368CD02487EBC1AF999FED34672E38167BCB2|yxnB]

2024-07-10 16:56:57

ghost

57

4e575af872ba95e2cf90fe572e62500dbeeb237b

313B46B7C64D64F3047B680AB2010FF8D128F6EB

genes
[gene|787BB72119DB1321A8281D7C46FED28CAEDBC97C|yxbB]-[gene|88B01CC87394AEE693A98574F9343EBF99F0D60E|yxbA]-[gene|A15368CD02487EBC1AF999FED34672E38167BCB2|yxnB]-[gene|9446D9C88CBBBC5A08495D8AA49A92A9F47F2C9B|asnH]-[gene|BF0E188249161B3CC24D223FDD48B820EBED8F55|yxaM]
description
[Pubmed|10746760]
regulation
repressed by glucose (8-fold) [Pubmed|12850135]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|12618455], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|15101989], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|20185509], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|787BB72119DB1321A8281D7C46FED28CAEDBC97C|yxbB]→[gene|BF0E188249161B3CC24D223FDD48B820EBED8F55|yxaM]

2024-07-03 12:00:24

ghost

63

b92c3bd2849e2809ddcc3c320eae6fb9d682a8b4

5C58E2063585752CCDF4E84423501D1D48511254

Biological materials
Mutant
MGNA-B690 (yxbB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1689 NBRP B. subtilis, Japan]
BKE39890 ([gene|787BB72119DB1321A8281D7C46FED28CAEDBC97C|yxbB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE39890 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTCAGCATCCTCCTTA,  downstream forward: _UP4_AAAGAAAAGGAAGGTGCATT
BKK39890 ([gene|787BB72119DB1321A8281D7C46FED28CAEDBC97C|yxbB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK39890 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTCAGCATCCTCCTTA,  downstream forward: _UP4_AAAGAAAAGGAAGGTGCATT
References
10746760,18083814,12618455,10498721,12618455,15101989,12850135,20185509,20525796,21815947

787BB72119DB1321A8281D7C46FED28CAEDBC97C

Page visits: 3969

Time of last update: 2024-07-15 06:57:52

Author of last update: Jstuelk