pxpA

pxpA
168

subunit of [metabolite|ATP]-dependent 5-oxoprolinase

locus
BSU_04050
Molecular weight
27.39 kDa
pI
5.58
Protein length
Gene length
function
detoxification of [metabolite|5-oxoproline]
product
subunit of 5-oxoprolinase
essential
no
synonyms
pxpA, ycsF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1540 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
457,023  457,796
Phenotypes of a mutant
no growth with [metabolite|5-oxoproline] as single source of nitrogen [pubmed|28830929]
reduced growth with [metabolite|ammonium] as source of nitrogen due to the accumulation of toxic [metabolite|5-oxoproline] [pubmed|28830929]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
[metabolite|5-oxoproline] + [metabolite|ATP] --> [metabolite|glutamate] + [metabolite|ADP] + Pi [pubmed|28830929]
Protein family
LamB/PxpA family (single member, according to UniProt)
Structure
[PDB|1V6T] (from ''Pyrococcus horikoshii'', 52% identity)
[AF|P42963]
Kinetic information
Km ([metabolite|5-oxoproline]): 39 M [pubmed|28830929]
Expression and Regulation
Operons
genes
[gene|77F758CE9A59AC41F283CB1F5099097386133799|pxpA]-[gene|9AD419E3CB86C54A0F11E96C82E80A357C6B23D2|ycsG]-[gene|312E2A4ADFBCB9DD9AD9EEEC9FE53F3932AF5DBA|ycsI]-[gene|5A5E17D39296FECC1C03B1A7791AB1065BB4E4DF|pxpB]-[gene|3BA8F1F71B1D65EB30867ABD27867F925DAD2D7B|pxpC]-[gene|7DA9A79876C546B78B716A64706A3A3716018C2E|kipR]-[gene|05910B4500420D4DB75DAD3A7A2358C360FF2154|lipC]
description
[Pubmed|9334321]
regulation
induced in the presence of 5-oxoproline [pubmed|28830929]
regulatory mechanism
[protein|7DA9A79876C546B78B716A64706A3A3716018C2E|kipR]: repression, [Pubmed|9334321], in [regulon|protein:7DA9A79876C546B78B716A64706A3A3716018C2E|kipR regulon]
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: activation, [Pubmed|9334321], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
Open in new tab

[gene|77F758CE9A59AC41F283CB1F5099097386133799|pxpA]→[gene|05910B4500420D4DB75DAD3A7A2358C360FF2154|lipC]

2024-06-19 20:17:09

Jstuelk

73

2e345e8dee0849e85fe094a123ef62dc61c60b82

B227AB4ADF5839F5D85D0A01462013A7CDA6A81D

Biological materials
Mutant
MGNA-C072 (ycsF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2070 NBRP B. subtilis, Japan]
BKE04050 ([gene|77F758CE9A59AC41F283CB1F5099097386133799|pxpA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04050 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAGAATCCCTCCTGCCAA,  downstream forward: _UP4_TCAACATAAAGGAGGAACAA
BKK04050 ([gene|77F758CE9A59AC41F283CB1F5099097386133799|pxpA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04050 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACAGAATCCCTCCTGCCAA,  downstream forward: _UP4_TCAACATAAAGGAGGAACAA
References
9334321,25755103,28830929

77F758CE9A59AC41F283CB1F5099097386133799

Page visits: 2266

Time of last update: 2024-06-20 16:43:42

Author of last update: Jstuelk