yugO

yugO
168

potassium channel protein (exporter)

locus
BSU_31322
Molecular weight
37.00 kDa
pI
7
Protein length
Gene length
function
potassium exporter
product
potassium channel protein
essential
no
synonyms
yugO

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0569 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,218,854  3,219,840
Phenotypes of a mutant
reduced [wiki|biofilm formation] (can be suppressed by inactivation of ''[gene|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]'') [Pubmed|23737939]
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
[wiki|Domains]
contains a [wiki|RCK_N domain] (aa 116-245) (according to [http://www.uniprot.org/uniprot/?query=RCK+N-terminal+domain&sort=score UniProt])
Structure
[PDB|3RBZ] (from Methanothermobacter thermautotrophicus, 24% identity)
[AF|Q795M8]
[wiki|Localization]
inner spore membrane [Pubmed|26731423]
Additional information
potassium exporter activity of YugO is activated by glutamate limitation via the C-terminal domain [Pubmed|26503040]
Expression and Regulation
Operons
genes
[gene|C5C72925567927CC177CCAC5369F80D57B9FAB5F|mstX]-[gene|752860E73AD1A72D6598F995B80F5B21A77A5CBD|yugO]
description
[Pubmed|23737939]
regulation
repressed by [protein|search|SinR] [Pubmed|23737939]
regulatory mechanism
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, [Pubmed|23737939], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
additional information
potassium exporter activity of YugO is activated by glutamate limitation via the C-terminal domain [Pubmed|26503040]
Open in new tab

[gene|C5C72925567927CC177CCAC5369F80D57B9FAB5F|mstX]→[gene|752860E73AD1A72D6598F995B80F5B21A77A5CBD|yugO]

2024-07-07 05:20:17

ghost

90

85f2f42956c5da924414be7f576e297b57104a91

B36C37BD378E93291602921CA84AE3502A5DD7AC

Biological materials
Mutant
MGNA-A624 (yugO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/624 NBRP B. subtilis, Japan]
GP2098 (''yugO''::''ermC''), available in [wiki|Jörg Stülke]'s lab [pubmed|28679749]
GP2296 (''yugO''::''tet''), available in [wiki|Jörg Stülke]'s lab
BKE31322 ([gene|752860E73AD1A72D6598F995B80F5B21A77A5CBD|yugO]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE31322 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGAAATAAATATCCGATTTG,  downstream forward: _UP4_GAAACAGATCAATTCCTTGC
BKK31322 ([gene|752860E73AD1A72D6598F995B80F5B21A77A5CBD|yugO]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK31322 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TGAAATAAATATCCGATTTG,  downstream forward: _UP4_GAAACAGATCAATTCCTTGC
FLAG-tag construct
GP2442 ''yugO-3xFLAG spc'' (based on [wiki|pGP1331]), available in [wiki|Jörg Stülke]'s lab
References
Reviews
26503058,27935846,28086088,28622518,31361596,33288383,35195292
Original Publications
23737939,26503040,26731423,10617203,28086091,28386026

752860E73AD1A72D6598F995B80F5B21A77A5CBD

Page visits: 4537

Time of last update: 2024-07-15 06:19:48

Author of last update: Jstuelk