pyrR

pyrR
168

transcriptional termination factor of the pyr operon

locus
BSU_15470
Molecular weight
20.12 kDa
pI
4.99
Protein length
Gene length
function
regulation of pyrimidine biosynthesis
product
transcriptional termination protein with minor uracil phosphoribosyltransferase activity
essential
no
ec
2.4.2.9
synonyms
pyrR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2065 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,618,304  1,618,849
Visit Sartorius.com Visit Sartorius.com
Advertisement
The protein
Catalyzed reaction/ biological activity
diphosphate + UMP --> 5-phospho-α-D-ribose 1-diphosphate + uracil (according to UniProt)
Protein family
[wiki|Purine/pyrimidine phosphoribosyltransferase family] (according to UniProt)
Structure
[PDB|1A3C] (dimeric form)
[AF|P39765]
Effectors of protein activity
UMP and UTP stimulate the RNA-binding activity of PyrR, resulting of transcription termination of the [gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]-[gene|A5C26E10085868A0A193C450DF58D54C636B7C2D|pyrP]-[gene|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB]-[gene|CA16FD3507DCCADB1E01DF25B42C3405C9205B05|pyrC]-[gene|E7741ED6F15044900BDC5F0584246469D2D4D586|pyrAA]-[gene|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB]-[gene|C20A05AE4CE8AEE0DA767334935CC64106A7FCCB|pyrK]-[gene|E533BEF28579CD04B24E2C728737269E35224450|pyrD]-[gene|5D0D0D2413377FCA92440334E92B5A27A5963D9E|pyrF]-[gene|0197A037D2AF049B295E1DA60187D4614B2BAC51|pyrE] operon [pubmed|31100987]
Expression and Regulation
Operons
genes
[gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]-[gene|A5C26E10085868A0A193C450DF58D54C636B7C2D|pyrP]-[gene|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB]-[gene|CA16FD3507DCCADB1E01DF25B42C3405C9205B05|pyrC]-[gene|E7741ED6F15044900BDC5F0584246469D2D4D586|pyrAA]-[gene|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB]-[gene|C20A05AE4CE8AEE0DA767334935CC64106A7FCCB|pyrK]-[gene|E533BEF28579CD04B24E2C728737269E35224450|pyrD]-[gene|5D0D0D2413377FCA92440334E92B5A27A5963D9E|pyrF]-[gene|0197A037D2AF049B295E1DA60187D4614B2BAC51|pyrE]
description
[Pubmed|8206849]
regulation
induced in the absence of uridine nucleotides ([protein|search|PyrR]) [Pubmed|8206849]
regulatory mechanism
[protein|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]: termination, via [wiki|RNA switch], in [regulon|protein:6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|1709162], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]→[gene|0197A037D2AF049B295E1DA60187D4614B2BAC51|pyrE]

2024-06-18 17:36:24

ghost

90

3b978222b0b6a5230a2e7701ac35d1e35cc85307

0A8FD5CB6489EDD8CB2074130B763DCAC1F24654

genes
[gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]
description
[Pubmed|22383849]
Open in new tab

[gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]

2024-07-08 15:25:41

Jstuelk

44

305c42415b64122f6470a1378562465d671b32a9

C4B357F72FB9F3205FCEF82A9CAF6DEBE1BFCA8C

genes
[gene|8FC1A0A6C9975F6C125490FBAAB2A4957210A9F1|lspA]-[gene|C8C2E2F1B739F3D9A2FA6B460998708AAB2DA495|ylyB]-[gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]
description
[Pubmed|22383849]
Open in new tab

[gene|8FC1A0A6C9975F6C125490FBAAB2A4957210A9F1|lspA]→[gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]

2024-06-30 04:07:02

Jstuelk

60

8de7ab701af29d04cf1775c3714df5244d59efd2

D260A981278938463A8A0903EAC8DF3268BD4008

Biological materials
Mutant
BKE15470 ([gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE15470 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGTGTGACACCTCACAG,  downstream forward: _UP4_GCCATTTATGAAAACGAATA
BKK15470 ([gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK15470 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATGTGTGACACCTCACAG,  downstream forward: _UP4_GCCATTTATGAAAACGAATA
References
Reviews
28031352,31100987,32850966
Original Publications
8935652,8206849,15716449,11726695,9488732,9551555,12896995,9932459,8955403,8824632,12482852,1709162,7798145,11948166,8759868,7868607,9488732,17322189

6D9CEDC7737CCFA838EBC142CD735E066C950AD2

Page visits: 4286

Time of last update: 2024-07-14 04:03:25

Author of last update: Jstuelk