

transcriptional regulator of the extracellular matrix genes, acts in parallel to [protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR], [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB], and [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]

Molecular weight
9.71 kDa
Protein length
Gene length
control of biofilm formation
regulator of the extracellular matrix genes
remA, ylzA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2052 (Galperin et al., 2021)

This gene is a member of the following regulons

1,641,672  1,641,941
Visit Visit
The protein
Catalyzed reaction/ biological activity
binds [gene|FB2220730013A98D7C979062A4A451518B92DF09|opuAA], [gene|8C13E1EF5437DD8F9906643DEDCBB18DABE3B9E3|tapA], and [gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA] promoter regions (upstream of the actual promoter) to activate transcription [Pubmed|23646920]
binds DNA with high co-operativity due to low conserrvation of binding sites [Pubmed|23646920]
Protein family
RemA family (single member, according to UniProt)
[PDB|7BM2] [pubmed|34588455]
Expression and Regulation
expressed during vegetative growth and early during sporulation in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]) [Pubmed|23396918]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|23396918], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
Open in new tab


2024-07-13 21:18:53





Open in new tab


2024-07-05 05:28:41





expressed during sporulation in the mother cell [pubmed|12161109]
Open in new tab


2024-06-08 17:41:34





Biological materials
BKE15670 ([gene|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTCTACGTTCCCCCTG,  downstream forward: _UP4_GATGAAGGGCAGGGGTAATT
BKK15670 ([gene|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|remA]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCTTCTACGTTCCCCCTG,  downstream forward: _UP4_GATGAAGGGCAGGGGTAATT
[wiki|Daniel Kearns], Indiana University, Bloomington, USA, [ homepage]
Original Publications


Page visits: 5105

Time of last update: 2024-07-14 22:03:51

Author of last update: Jstuelk