

glutamine synthetase, trigger enzyme

Molecular weight
50.11 kDa
Protein length
Gene length
glutamine biosynthesis, control of [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA] and [protein|641C4BDD9702804642E1753A9C779E80FABB3919|glnR] activity
glutamine synthetase, trigger enzyme

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0174 (Galperin et al., 2021)

This gene is a member of the following regulons

1,878,425 1,879,759
Phenotypes of a mutant
auxotrophic for glutamine
defective in swarming motility (reduced rate of colony expansion) [pubmed|35638827]
Visit Visit
The protein
Catalyzed reaction/ biological activity
ATP + L-glutamate + NH4+ --> ADP + H+ + L-glutamine + phosphate (according to UniProt)
Protein family
glutamine synthetase family (single member, according to UniProt)
glutamate binding flap (aa 300 ... 306: protects unstable intermediates from abberant hydrolysis)
[PDB|4LNN] (apo-GS) [Pubmed|24158439]
[PDB|4S0R] (the [protein|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]-[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA] complex) [pubmed|25691471]
[PDB|7TFC] (the [protein|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]-[protein|641C4BDD9702804642E1753A9C779E80FABB3919|glnR] (C tail peptide) complex) [pubmed|35778410]
phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
''in vitro'' phosphorylated by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|prkC] on Thr-26, Thr-147, Ser-207, and Thr-286 [Pubmed|20389117]
Effectors of protein activity
feedback inhibition by glutamine, glutamine binds the entrance site for glutamate
activity is inhibited upon interaction with [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA] [Pubmed|23535029]
Kinetic information
K(M) for: Glu: 27 mM, ATP: 2.4 mM, ammonium: 0.18 mM; v(max): 3.7 mol/min/mg
cytoplasm (according to Swiss-Prot)
Additional information
GlnA is a homooligomer of 12 subunits
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
expressed in the absence of glutamine ([protein|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]) [Pubmed|8636055]
the mRNA is processed between [gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR] and [gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|ricA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|ricF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|ricT] complex [Pubmed|29794222]
regulatory mechanism
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: repression, [Pubmed|8799114], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
[protein|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]: repression, in complex with [protein|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA], in [regulon|protein:641C4BDD9702804642E1753A9C779E80FABB3919|glnR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2906311], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2024-06-19 00:59:41





the mRNA is processed between [gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR] and [gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|ricA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|ricF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|ricT] complex [Pubmed|29794222]
Open in new tab


2024-07-01 10:58:23





Open in new tab


2024-07-04 06:39:47





Biological materials
GP4718 Δ[gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]::cat, available in [wiki|Jörg Stülke]'s lab
BKE17460 (''glnA''::''ermC'') (available at the [ BGSC] and in [wiki|Jörg Stülke]'s lab) [pubmed|28189581]
GP2263 (''glnA''::''ermC'') (available in [wiki|Jörg Stülke]'s lab)
BP148 (del([gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]-[gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA])::''cat''), available in [wiki|Fabian Commichau]'s lab
GP1883 (del(''[gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]-[gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]'')::''ermC''), available in [wiki|Fabian Commichau]'s and [wiki|Jörg Stülke]'s labs
BKE17460 ([gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTAAAATTCCTCCT, downstream forward: _UP4_TAATATCTCAATCCCTTGGC
BKK17460 ([gene|68F4E792B99F86AE9E8F06D2200E128937331F5D|glnA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTAAAATTCCTCCT, downstream forward: _UP4_TAATATCTCAATCCCTTGGC
Expression vectors
pGP174: expression/ purification from ''E. coli'', with N-terminal Strep-tag (in [wiki|pGP172]): , available in [wiki|Jörg Stülke]'s lab
pGP177: N-terminal Strep-tag, purification from ''B. subtilis'', for [wiki|SPINE], in [wiki|pBQ200], available in [wiki|Jörg Stülke]'s lab
pGP2832: N-terminal Strep-tag, purification from ''B. subtilis'', for [wiki|SPINE], in [wiki|pGP380], available in [wiki|Jörg Stülke]'s lab
lacZ fusion
''[gene|641C4BDD9702804642E1753A9C779E80FABB3919|glnR]-lacZ'': pGP189 (in [wiki|pAC7]), available in [wiki|Jörg Stülke]'s lab
available in [wiki|Karl Forchhammer]'s lab
[wiki|Susan Fisher], Boston, USA [ homepage]
Original Publications


Page visits: 28096

Time of last update: 2024-07-24 09:21:55

Author of last update: Jstuelk